Incidental Mutation 'R6824:Myb'
ID534062
Institutional Source Beutler Lab
Gene Symbol Myb
Ensembl Gene ENSMUSG00000019982
Gene Namemyeloblastosis oncogene
Synonymsc-myb
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6824 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location21124935-21160984 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 21145120 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 470 (H470L)
Ref Sequence ENSEMBL: ENSMUSP00000139699 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020158] [ENSMUST00000188495]
Predicted Effect probably benign
Transcript: ENSMUST00000020158
SMART Domains Protein: ENSMUSP00000020158
Gene: ENSMUSG00000019982

DomainStartEndE-ValueType
low complexity region 7 27 N/A INTRINSIC
SANT 39 88 9.52e-20 SMART
SANT 91 140 2.04e-19 SMART
SANT 143 191 1.75e-18 SMART
low complexity region 227 239 N/A INTRINSIC
Pfam:LMSTEN 267 313 4e-29 PFAM
Pfam:Cmyb_C 399 559 1.5e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188495
AA Change: H470L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000139699
Gene: ENSMUSG00000019982
AA Change: H470L

DomainStartEndE-ValueType
low complexity region 7 27 N/A INTRINSIC
SANT 39 88 9.52e-20 SMART
SANT 91 140 2.04e-19 SMART
SANT 143 191 1.75e-18 SMART
low complexity region 227 239 N/A INTRINSIC
Pfam:LMSTEN 266 313 3.6e-32 PFAM
low complexity region 409 421 N/A INTRINSIC
Pfam:Cmyb_C 516 682 8.5e-66 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with three HTH DNA-binding domains that functions as a transcription regulator. This protein plays an essential role in the regulation of hematopoiesis. This gene may be aberrently expressed or rearranged or undergo translocation in leukemias and lymphomas, and is considered to be an oncogene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for deficient alleles of this gene display severe hematopoietic abnormalities. Red and white blood cells and platelets are all affected. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adck2 A G 6: 39,575,124 D275G probably benign Het
Cdh4 G A 2: 179,797,558 R166H probably damaging Het
Chl1 A G 6: 103,714,549 K1051E probably damaging Het
Chn2 A T 6: 54,272,953 M16L probably benign Het
Cmas A G 6: 142,771,236 T285A possibly damaging Het
Cnga4 A T 7: 105,406,829 M213L probably benign Het
Ctif C T 18: 75,521,711 R248Q probably damaging Het
Cyth3 T C 5: 143,686,510 I60T probably damaging Het
Dach1 A G 14: 98,018,892 I310T possibly damaging Het
Defb6 T C 8: 19,228,083 I57T probably benign Het
Dnajc27 T C 12: 4,106,897 V262A possibly damaging Het
Emsy G A 7: 98,593,407 T1175M probably benign Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Fam50b G A 13: 34,747,101 E187K possibly damaging Het
Fat4 T A 3: 38,957,525 V2258E probably benign Het
Gm136 G A 4: 34,746,591 T140I probably benign Het
Gm1673 T C 5: 33,983,725 probably benign Het
Gps1 T C 11: 120,787,428 F265S probably damaging Het
Grik5 C T 7: 25,046,355 R431Q possibly damaging Het
Hnrnpul2 T C 19: 8,826,717 V560A possibly damaging Het
Kmt2b A G 7: 30,586,276 probably benign Het
Krt8 T C 15: 101,998,440 N317S possibly damaging Het
Lad1 A G 1: 135,827,741 T252A probably benign Het
Maml2 G A 9: 13,697,217 S743N possibly damaging Het
Mrpl9 C A 3: 94,443,370 P7H possibly damaging Het
Nr1i3 T C 1: 171,214,973 I56T probably benign Het
Nrd1 A G 4: 109,043,425 Y338C probably damaging Het
Olfr702 A G 7: 106,824,457 V23A probably benign Het
Pcdhb20 T A 18: 37,505,699 M426K probably benign Het
Pde6d T C 1: 86,545,763 T104A possibly damaging Het
Ptprz1 A T 6: 23,002,131 T1407S probably benign Het
Recql5 C T 11: 115,923,212 R369Q possibly damaging Het
Rnf180 T A 13: 105,181,515 D463V probably damaging Het
Sart3 C T 5: 113,744,539 probably null Het
Sdk2 T C 11: 113,867,934 D488G probably benign Het
Slc9a9 C T 9: 95,227,198 P538S probably damaging Het
Snap29 A G 16: 17,422,506 K159E probably benign Het
Spaca1 A G 4: 34,049,869 V43A probably benign Het
Stk10 T C 11: 32,587,363 S191P probably damaging Het
Tbc1d1 A G 5: 64,256,902 H73R probably benign Het
Tcerg1l A G 7: 138,394,115 probably null Het
Tmem67 T C 4: 12,051,449 Y793C probably damaging Het
Ttll12 A T 15: 83,591,377 probably null Het
Vmn2r61 G T 7: 42,299,979 V608L probably benign Het
Xpo4 A T 14: 57,613,403 I348N probably damaging Het
Zfp941 G A 7: 140,812,699 T249M probably benign Het
Other mutations in Myb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00654:Myb APN 10 21141826 missense probably damaging 0.99
IGL00707:Myb APN 10 21148384 missense probably damaging 1.00
IGL00796:Myb APN 10 21141799 missense probably benign 0.00
IGL01012:Myb APN 10 21146260 missense probably benign 0.03
IGL01082:Myb APN 10 21152944 missense probably damaging 1.00
IGL01365:Myb APN 10 21152502 missense probably benign 0.31
IGL01906:Myb APN 10 21152634 missense probably damaging 1.00
IGL02560:Myb APN 10 21152448 missense probably damaging 1.00
Huang_river UTSW 10 21152617 missense probably damaging 1.00
PIT4495001:Myb UTSW 10 21152622 missense probably damaging 0.98
R0385:Myb UTSW 10 21154712 missense possibly damaging 0.73
R0442:Myb UTSW 10 21126196 missense probably benign 0.05
R0759:Myb UTSW 10 21145028 missense probably benign 0.01
R0882:Myb UTSW 10 21156360 missense possibly damaging 0.75
R0920:Myb UTSW 10 21126234 missense possibly damaging 0.80
R1401:Myb UTSW 10 21152945 missense probably damaging 1.00
R1651:Myb UTSW 10 21126198 missense probably damaging 1.00
R1752:Myb UTSW 10 21156437 missense possibly damaging 0.89
R1879:Myb UTSW 10 21141977 missense probably benign 0.24
R1971:Myb UTSW 10 21140656 missense probably benign 0.00
R4355:Myb UTSW 10 21152617 missense probably damaging 1.00
R4611:Myb UTSW 10 21145324 missense probably damaging 1.00
R4650:Myb UTSW 10 21152941 missense probably damaging 1.00
R4888:Myb UTSW 10 21126238 missense probably benign 0.01
R5121:Myb UTSW 10 21126238 missense probably benign 0.01
R5922:Myb UTSW 10 21152927 missense probably damaging 1.00
R5955:Myb UTSW 10 21152499 missense probably damaging 1.00
R6116:Myb UTSW 10 21154754 missense probably damaging 1.00
R6150:Myb UTSW 10 21141769 missense probably damaging 1.00
R6207:Myb UTSW 10 21145322 missense probably benign
R6656:Myb UTSW 10 21152945 missense probably damaging 1.00
R6801:Myb UTSW 10 21144966 splice site probably null
R6884:Myb UTSW 10 21152532 missense probably damaging 1.00
R6977:Myb UTSW 10 21152652 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GCTCGGGTGTATGCTGAAAATTAG -3'
(R):5'- TCGTGGTGTGATCTCAGCAG -3'

Sequencing Primer
(F):5'- TAGTAACAGCTGTGCAGAAATTGTGC -3'
(R):5'- CAGTTTTGAATTCTCTGAAGAAGCGG -3'
Posted On2018-09-12