Incidental Mutation 'R6825:Fbxl19'
ID534107
Institutional Source Beutler Lab
Gene Symbol Fbxl19
Ensembl Gene ENSMUSG00000030811
Gene NameF-box and leucine-rich repeat protein 19
SynonymsFbl19
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.912) question?
Stock #R6825 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location127744543-127769483 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 127750015 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 119 (I119K)
Ref Sequence ENSEMBL: ENSMUSP00000140303 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033081] [ENSMUST00000186116] [ENSMUST00000186207] [ENSMUST00000188580] [ENSMUST00000189562] [ENSMUST00000205689] [ENSMUST00000206893]
Predicted Effect probably damaging
Transcript: ENSMUST00000033081
AA Change: I119K

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000033081
Gene: ENSMUSG00000030811
AA Change: I119K

DomainStartEndE-ValueType
Pfam:zf-CXXC 11 57 1.7e-16 PFAM
PHD 67 129 4e-4 SMART
low complexity region 166 183 N/A INTRINSIC
low complexity region 302 325 N/A INTRINSIC
low complexity region 355 377 N/A INTRINSIC
FBOX 404 444 4.6e-4 SMART
low complexity region 509 520 N/A INTRINSIC
LRR 576 601 3.58e1 SMART
LRR 631 656 1.28e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000186116
SMART Domains Protein: ENSMUSP00000140083
Gene: ENSMUSG00000030811

DomainStartEndE-ValueType
low complexity region 10 33 N/A INTRINSIC
low complexity region 63 85 N/A INTRINSIC
FBOX 112 152 3e-6 SMART
low complexity region 217 228 N/A INTRINSIC
LRR 284 309 1.5e-1 SMART
LRR 339 364 5.3e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000186207
AA Change: I119K

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000140303
Gene: ENSMUSG00000030811
AA Change: I119K

DomainStartEndE-ValueType
Pfam:zf-CXXC 11 57 1.7e-16 PFAM
PHD 67 129 4e-4 SMART
low complexity region 166 183 N/A INTRINSIC
low complexity region 302 325 N/A INTRINSIC
low complexity region 355 377 N/A INTRINSIC
FBOX 404 444 4.6e-4 SMART
low complexity region 509 520 N/A INTRINSIC
LRR 576 601 3.58e1 SMART
LRR 631 656 1.28e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000188580
AA Change: I119K

PolyPhen 2 Score 0.478 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000140021
Gene: ENSMUSG00000030811
AA Change: I119K

DomainStartEndE-ValueType
Pfam:zf-CXXC 11 57 1.3e-16 PFAM
PHD 67 129 4e-4 SMART
low complexity region 186 209 N/A INTRINSIC
low complexity region 239 261 N/A INTRINSIC
FBOX 288 328 4.6e-4 SMART
low complexity region 393 404 N/A INTRINSIC
LRR 460 485 3.58e1 SMART
LRR 515 540 1.28e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000189562
SMART Domains Protein: ENSMUSP00000139972
Gene: ENSMUSG00000030811

DomainStartEndE-ValueType
Pfam:zf-CXXC 11 57 9.3e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205689
Predicted Effect possibly damaging
Transcript: ENSMUST00000206893
AA Change: I119K

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
Meta Mutation Damage Score 0.036 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Skp1-Cullin-F-box family of E3 ubiquitin ligases. The encoded protein is reported to bind to the transmembrane receptor interleukin 1 receptor-like 1 and regulate its ubiquitination and degradation. This protein has been linked to the regulation of pulmonary inflammation and psoriasis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik A T 12: 72,907,880 S206T probably benign Het
Aasdh A T 5: 76,888,849 probably null Het
Adam10 G T 9: 70,761,602 C400F probably damaging Het
Ankle2 A T 5: 110,250,769 R561S probably null Het
Arhgef5 C T 6: 43,274,961 T882I probably damaging Het
Arpc1a A T 5: 145,096,126 K82* probably null Het
Card11 C A 5: 140,878,082 R967L probably benign Het
Ccdc82 G T 9: 13,251,976 probably benign Het
Cebpz T C 17: 78,919,963 D1026G probably damaging Het
Cit A T 5: 115,981,774 Q1321L probably damaging Het
Clcn2 C A 16: 20,709,658 probably benign Het
Csf3 G C 11: 98,702,447 G130A probably damaging Het
Cul2 T A 18: 3,434,946 S737T probably damaging Het
Cyp1a2 G A 9: 57,677,260 H504Y probably benign Het
Cyp3a44 G A 5: 145,779,586 P398L probably damaging Het
Dnah8 T C 17: 30,741,173 I2206T probably damaging Het
Efr3a G A 15: 65,829,830 V198I probably benign Het
Epb41l5 A T 1: 119,620,201 D157E possibly damaging Het
Ercc8 T C 13: 108,158,809 S6P probably damaging Het
Faxc T C 4: 21,931,672 S37P probably benign Het
Frmd4b A G 6: 97,325,476 V195A possibly damaging Het
Fut9 A T 4: 25,619,925 S296R probably benign Het
Gas6 T C 8: 13,483,674 N112D probably benign Het
H2-Q1 T C 17: 35,321,052 L99P probably damaging Het
Helq A T 5: 100,792,695 I346N probably damaging Het
Hepacam A G 9: 37,367,680 K2E possibly damaging Het
Itgae T C 11: 73,118,496 M502T possibly damaging Het
Kmt2a G A 9: 44,818,407 probably benign Het
Lhx9 ACC ACCC 1: 138,841,806 probably null Het
Macf1 A T 4: 123,383,222 probably null Het
Mgat4a T A 1: 37,464,434 K220* probably null Het
Olfr1199 T C 2: 88,755,911 I255V possibly damaging Het
Olfr1469 G A 19: 13,411,150 V194I probably benign Het
Olfr224 T C 11: 58,566,650 R232G possibly damaging Het
Pex5 A T 6: 124,414,381 M18K probably damaging Het
Phlda3 T C 1: 135,766,824 *126Q probably null Het
Plxna1 G T 6: 89,320,615 D1862E probably benign Het
Pold4 A T 19: 4,232,110 I7F possibly damaging Het
Prkaa1 A T 15: 5,143,950 I19F possibly damaging Het
Prl7d1 T G 13: 27,710,142 E148A probably benign Het
Prr14l A T 5: 32,828,548 V1201E possibly damaging Het
Rab3gap1 T C 1: 127,930,421 C510R probably damaging Het
Rhbdf1 C T 11: 32,209,970 R802H probably damaging Het
Rpl18a A C 8: 70,896,192 F47V probably damaging Het
Sema5b C A 16: 35,628,007 probably null Het
Sspo G A 6: 48,465,525 G1985R probably benign Het
Tcaf2 C T 6: 42,629,518 A501T probably benign Het
Tcerg1 A G 18: 42,548,477 D563G probably damaging Het
Tdh G A 14: 63,495,832 T155M probably damaging Het
Tenm2 T C 11: 36,046,884 N1654S probably benign Het
Tlr5 A T 1: 182,973,044 probably benign Het
Tns1 G T 1: 74,002,323 C136* probably null Het
Tomm5 A T 4: 45,106,443 probably null Het
Trio A T 15: 27,889,308 F512I probably damaging Het
Ttll5 A T 12: 85,883,328 probably null Het
Upp1 T A 11: 9,131,707 H81Q probably benign Het
Usp42 A G 5: 143,727,807 S71P probably damaging Het
Vamp5 G A 6: 72,380,441 probably benign Het
Zap70 A G 1: 36,778,390 Y238C probably damaging Het
Zfp398 A G 6: 47,866,331 D307G probably damaging Het
Other mutations in Fbxl19
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0559:Fbxl19 UTSW 7 127750218 missense possibly damaging 0.51
R1933:Fbxl19 UTSW 7 127750929 missense probably benign
R2280:Fbxl19 UTSW 7 127748368 missense possibly damaging 0.80
R2935:Fbxl19 UTSW 7 127752260 missense probably damaging 0.97
R5580:Fbxl19 UTSW 7 127750996 nonsense probably null
R6032:Fbxl19 UTSW 7 127761265 missense probably damaging 1.00
R6032:Fbxl19 UTSW 7 127761265 missense probably damaging 1.00
R6054:Fbxl19 UTSW 7 127752509 missense probably damaging 0.99
R6540:Fbxl19 UTSW 7 127748353 utr 5 prime probably benign
R7136:Fbxl19 UTSW 7 127750045 missense possibly damaging 0.92
X0060:Fbxl19 UTSW 7 127767803 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- ATGGAGTGTACAATCTGCAACG -3'
(R):5'- TAGGTTAGCGCCTTCCTCAC -3'

Sequencing Primer
(F):5'- TGTACAATCTGCAACGAGATCG -3'
(R):5'- ACCATTGTCAGCCCTGCG -3'
Posted On2018-09-12