Incidental Mutation 'R6826:Akr1c12'
ID534181
Institutional Source Beutler Lab
Gene Symbol Akr1c12
Ensembl Gene ENSMUSG00000021211
Gene Namealdo-keto reductase family 1, member C12
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R6826 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location4268176-4279433 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4275734 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 120 (V120A)
Ref Sequence ENSEMBL: ENSMUSP00000021632 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021632]
Predicted Effect probably benign
Transcript: ENSMUST00000021632
AA Change: V120A

PolyPhen 2 Score 0.060 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000021632
Gene: ENSMUSG00000021211
AA Change: V120A

DomainStartEndE-ValueType
Pfam:Aldo_ket_red 18 301 1.1e-63 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 T C 11: 110,216,605 N728S probably benign Het
Acaca T C 11: 84,195,536 S63P probably damaging Het
Ap4b1 G A 3: 103,812,908 probably null Het
Apol7e T A 15: 77,718,291 V363D probably damaging Het
Bmpr1b A T 3: 141,857,406 L259Q probably damaging Het
Clca3a2 T C 3: 144,818,054 T57A possibly damaging Het
Copb1 T C 7: 114,226,719 T677A probably benign Het
Crhr2 T C 6: 55,117,740 probably benign Het
Cyp11a1 A G 9: 58,025,087 T228A probably damaging Het
Dnah1 T C 14: 31,286,290 I2084V probably benign Het
Dnajc17 T C 2: 119,180,927 K174R probably damaging Het
Dnm2 T A 9: 21,504,471 Y646* probably null Het
Dock9 G A 14: 121,622,918 P866L probably damaging Het
Elmo3 A T 8: 105,306,746 I115F probably damaging Het
Elmod1 T C 9: 53,919,599 T268A probably benign Het
F10 T C 8: 13,046,165 probably null Het
Fmo4 C T 1: 162,803,769 V210M probably damaging Het
Foxred2 G T 15: 77,947,085 H509Q probably benign Het
Gm28710 A G 5: 16,808,294 I219V unknown Het
Hyal6 A G 6: 24,734,372 I101M probably damaging Het
Igkv5-48 T C 6: 69,726,600 Y107C probably damaging Het
Jag1 A G 2: 137,116,175 probably null Het
Leng8 T A 7: 4,145,320 V697E probably damaging Het
Mdga1 T C 17: 29,970,026 N21S unknown Het
Midn T A 10: 80,154,127 C126* probably null Het
Mlh3 A T 12: 85,245,824 V1303E probably benign Het
Myh4 T C 11: 67,246,531 L526P probably damaging Het
Olfr1117-ps1 G A 2: 87,284,328 E13K probably benign Het
Olfr1469 T A 19: 13,411,088 V173E probably benign Het
Pde6b C T 5: 108,430,592 R799* probably null Het
Pde9a A G 17: 31,466,440 D382G probably benign Het
Pdrg1 A C 2: 153,010,256 probably null Het
Peg10 C CATCAGGATG 6: 4,756,353 probably benign Het
Ppp1r3a C A 6: 14,718,981 E645* probably null Het
Prrc2b A G 2: 32,222,288 probably null Het
Ptprb T A 10: 116,317,372 M578K probably benign Het
Rasgrp3 G T 17: 75,503,246 V314F probably damaging Het
Rps9 C A 7: 3,705,776 D84E probably benign Het
Sdf2l1 C G 16: 17,132,294 R6P probably benign Het
Serpina1e A G 12: 103,949,138 F270L probably benign Het
Slc24a5 G A 2: 125,068,858 V70I probably benign Het
Slfn14 C A 11: 83,281,818 probably null Het
Smcr8 G T 11: 60,778,862 D279Y possibly damaging Het
Snx16 A T 3: 10,438,088 V33D probably damaging Het
Tesc A G 5: 118,056,418 T131A probably damaging Het
Tnfaip8l3 G T 9: 54,027,499 T64K possibly damaging Het
Vmn2r1 T A 3: 64,105,146 Y809* probably null Het
Vmn2r25 A G 6: 123,823,112 V757A probably damaging Het
Vmn2r3 A T 3: 64,274,906 Y457* probably null Het
Wee1 T C 7: 110,124,663 probably null Het
Wfdc3 C T 2: 164,734,258 G38R possibly damaging Het
Zfp541 A G 7: 16,078,982 E520G probably damaging Het
Zfp579 G T 7: 4,994,426 A162D probably benign Het
Zfp811 A G 17: 32,797,788 F425S probably damaging Het
Other mutations in Akr1c12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01479:Akr1c12 APN 13 4272935 missense probably benign 0.01
IGL01603:Akr1c12 APN 13 4272927 critical splice donor site probably null
IGL01935:Akr1c12 APN 13 4272245 missense probably damaging 0.99
IGL02066:Akr1c12 APN 13 4276237 missense probably damaging 0.96
IGL02224:Akr1c12 APN 13 4279290 missense probably damaging 0.98
IGL02277:Akr1c12 APN 13 4272269 missense probably damaging 1.00
IGL02425:Akr1c12 APN 13 4273750 missense probably damaging 1.00
IGL02884:Akr1c12 APN 13 4272212 missense possibly damaging 0.52
IGL02959:Akr1c12 APN 13 4279332 missense probably benign
IGL03075:Akr1c12 APN 13 4272255 missense probably damaging 1.00
R1216:Akr1c12 UTSW 13 4276323 missense probably benign 0.10
R1302:Akr1c12 UTSW 13 4272329 missense probably damaging 1.00
R1520:Akr1c12 UTSW 13 4276299 missense probably damaging 1.00
R2213:Akr1c12 UTSW 13 4276248 missense probably damaging 0.99
R3944:Akr1c12 UTSW 13 4279340 missense probably benign
R4671:Akr1c12 UTSW 13 4273817 missense possibly damaging 0.88
R6237:Akr1c12 UTSW 13 4275768 missense possibly damaging 0.51
R6266:Akr1c12 UTSW 13 4270207 missense probably benign
R6467:Akr1c12 UTSW 13 4275773 missense probably benign 0.10
R6865:Akr1c12 UTSW 13 4270213 missense possibly damaging 0.79
R6874:Akr1c12 UTSW 13 4272960 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- GGACGTCACTTCTAAGCTGTG -3'
(R):5'- AGAGAGAAGACCTGTTCATCAC -3'

Sequencing Primer
(F):5'- GACGTCACTTCTAAGCTGTGATTCTG -3'
(R):5'- CAAAGGTATAGTATGCAGATCACTG -3'
Posted On2018-09-12