Incidental Mutation 'R6826:Foxred2'
ID534185
Institutional Source Beutler Lab
Gene Symbol Foxred2
Ensembl Gene ENSMUSG00000016552
Gene NameFAD-dependent oxidoreductase domain containing 2
SynonymsD15Bwg0759e, A430097D04Rik, LOC239554
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6826 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location77940522-77956722 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 77947085 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 509 (H509Q)
Ref Sequence ENSEMBL: ENSMUSP00000113403 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016696] [ENSMUST00000117725]
Predicted Effect probably benign
Transcript: ENSMUST00000016696
AA Change: H509Q

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000016696
Gene: ENSMUSG00000016552
AA Change: H509Q

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Pyr_redox_2 22 243 2.9e-11 PFAM
Pfam:Pyr_redox_3 25 240 9.3e-35 PFAM
Pfam:NAD_binding_8 26 84 3.3e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117725
AA Change: H509Q

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000113403
Gene: ENSMUSG00000016552
AA Change: H509Q

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Pyr_redox_2 23 478 3.4e-9 PFAM
Pfam:Pyr_redox_3 25 240 6.2e-37 PFAM
Pfam:NAD_binding_8 26 90 4.8e-7 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 T C 11: 110,216,605 N728S probably benign Het
Acaca T C 11: 84,195,536 S63P probably damaging Het
Akr1c12 A G 13: 4,275,734 V120A probably benign Het
Ap4b1 G A 3: 103,812,908 probably null Het
Apol7e T A 15: 77,718,291 V363D probably damaging Het
Bmpr1b A T 3: 141,857,406 L259Q probably damaging Het
Clca3a2 T C 3: 144,818,054 T57A possibly damaging Het
Copb1 T C 7: 114,226,719 T677A probably benign Het
Crhr2 T C 6: 55,117,740 probably benign Het
Cyp11a1 A G 9: 58,025,087 T228A probably damaging Het
Dnah1 T C 14: 31,286,290 I2084V probably benign Het
Dnajc17 T C 2: 119,180,927 K174R probably damaging Het
Dnm2 T A 9: 21,504,471 Y646* probably null Het
Dock9 G A 14: 121,622,918 P866L probably damaging Het
Elmo3 A T 8: 105,306,746 I115F probably damaging Het
Elmod1 T C 9: 53,919,599 T268A probably benign Het
F10 T C 8: 13,046,165 probably null Het
Fmo4 C T 1: 162,803,769 V210M probably damaging Het
Gm28710 A G 5: 16,808,294 I219V unknown Het
Hyal6 A G 6: 24,734,372 I101M probably damaging Het
Igkv5-48 T C 6: 69,726,600 Y107C probably damaging Het
Jag1 A G 2: 137,116,175 probably null Het
Leng8 T A 7: 4,145,320 V697E probably damaging Het
Mdga1 T C 17: 29,970,026 N21S unknown Het
Midn T A 10: 80,154,127 C126* probably null Het
Mlh3 A T 12: 85,245,824 V1303E probably benign Het
Myh4 T C 11: 67,246,531 L526P probably damaging Het
Olfr1117-ps1 G A 2: 87,284,328 E13K probably benign Het
Olfr1469 T A 19: 13,411,088 V173E probably benign Het
Pde6b C T 5: 108,430,592 R799* probably null Het
Pde9a A G 17: 31,466,440 D382G probably benign Het
Pdrg1 A C 2: 153,010,256 probably null Het
Peg10 C CATCAGGATG 6: 4,756,353 probably benign Het
Ppp1r3a C A 6: 14,718,981 E645* probably null Het
Prrc2b A G 2: 32,222,288 probably null Het
Ptprb T A 10: 116,317,372 M578K probably benign Het
Rasgrp3 G T 17: 75,503,246 V314F probably damaging Het
Rps9 C A 7: 3,705,776 D84E probably benign Het
Sdf2l1 C G 16: 17,132,294 R6P probably benign Het
Serpina1e A G 12: 103,949,138 F270L probably benign Het
Slc24a5 G A 2: 125,068,858 V70I probably benign Het
Slfn14 C A 11: 83,281,818 probably null Het
Smcr8 G T 11: 60,778,862 D279Y possibly damaging Het
Snx16 A T 3: 10,438,088 V33D probably damaging Het
Tesc A G 5: 118,056,418 T131A probably damaging Het
Tnfaip8l3 G T 9: 54,027,499 T64K possibly damaging Het
Vmn2r1 T A 3: 64,105,146 Y809* probably null Het
Vmn2r25 A G 6: 123,823,112 V757A probably damaging Het
Vmn2r3 A T 3: 64,274,906 Y457* probably null Het
Wee1 T C 7: 110,124,663 probably null Het
Wfdc3 C T 2: 164,734,258 G38R possibly damaging Het
Zfp541 A G 7: 16,078,982 E520G probably damaging Het
Zfp579 G T 7: 4,994,426 A162D probably benign Het
Zfp811 A G 17: 32,797,788 F425S probably damaging Het
Other mutations in Foxred2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01394:Foxred2 APN 15 77955620 missense probably benign 0.30
IGL01479:Foxred2 APN 15 77952289 splice site probably null
IGL01748:Foxred2 APN 15 77952346 missense probably damaging 1.00
IGL02160:Foxred2 APN 15 77955650 missense probably benign 0.03
IGL02328:Foxred2 APN 15 77955832 missense probably damaging 1.00
IGL02630:Foxred2 APN 15 77947162 missense probably benign 0.05
IGL02672:Foxred2 APN 15 77945577 critical splice donor site probably null
soma UTSW 15 77953358 missense possibly damaging 0.78
R0271:Foxred2 UTSW 15 77943390 missense possibly damaging 0.68
R1386:Foxred2 UTSW 15 77948521 critical splice acceptor site probably null
R1581:Foxred2 UTSW 15 77955761 missense possibly damaging 0.94
R4399:Foxred2 UTSW 15 77953358 missense possibly damaging 0.78
R4399:Foxred2 UTSW 15 77955680 missense probably benign 0.06
R4528:Foxred2 UTSW 15 77943249 missense probably benign 0.01
R4937:Foxred2 UTSW 15 77955835 missense probably damaging 1.00
R5165:Foxred2 UTSW 15 77956012 missense probably damaging 1.00
R5318:Foxred2 UTSW 15 77952398 missense probably benign 0.00
R5893:Foxred2 UTSW 15 77947144 missense probably damaging 1.00
R6336:Foxred2 UTSW 15 77955764 missense probably damaging 0.99
R6370:Foxred2 UTSW 15 77943306 missense probably benign 0.01
R6426:Foxred2 UTSW 15 77953308 missense probably damaging 1.00
R6891:Foxred2 UTSW 15 77955709 missense probably damaging 1.00
R6934:Foxred2 UTSW 15 77952330 nonsense probably null
R7193:Foxred2 UTSW 15 77952030 missense probably damaging 1.00
Z1088:Foxred2 UTSW 15 77952003 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTACATAGTACCCAGAGACCATGTG -3'
(R):5'- ACAGCCTTTGAGTACCTGGAG -3'

Sequencing Primer
(F):5'- TCTGTCAGCTGCAGAAGTTC -3'
(R):5'- AGGAGTTCCCTATGCAGATGC -3'
Posted On2018-09-12