Incidental Mutation 'R6827:Cchcr1'
ID534226
Institutional Source Beutler Lab
Gene Symbol Cchcr1
Ensembl Gene ENSMUSG00000040312
Gene Namecoiled-coil alpha-helical rod protein 1
SynonymsHcr
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.370) question?
Stock #R6827 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location35517100-35531015 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 35530405 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 773 (T773A)
Ref Sequence ENSEMBL: ENSMUSP00000133407 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025273] [ENSMUST00000045956] [ENSMUST00000164242] [ENSMUST00000173903]
Predicted Effect probably benign
Transcript: ENSMUST00000025273
SMART Domains Protein: ENSMUSP00000025273
Gene: ENSMUSG00000024409

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
Pfam:SPR1 22 135 1.3e-56 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000045956
SMART Domains Protein: ENSMUSP00000046612
Gene: ENSMUSG00000040312

DomainStartEndE-ValueType
Pfam:HCR 27 767 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164242
SMART Domains Protein: ENSMUSP00000132028
Gene: ENSMUSG00000040312

DomainStartEndE-ValueType
Pfam:HCR 27 767 N/A PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000173903
AA Change: T773A

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000133407
Gene: ENSMUSG00000040312
AA Change: T773A

DomainStartEndE-ValueType
Pfam:HCR 110 855 N/A PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 97% (36/37)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef26 C A 3: 62,423,498 probably null Het
Asb3 A G 11: 31,101,211 N555S probably benign Het
Bcr T C 10: 75,131,064 V501A probably damaging Het
Dmxl1 C T 18: 49,921,024 P2566S probably damaging Het
Dscam T A 16: 97,038,991 N139Y probably damaging Het
Ephx1 A G 1: 180,989,888 L406P probably damaging Het
Fbxl13 T A 5: 21,522,178 I607F probably damaging Het
Gm35060 C T 18: 32,458,660 W186* probably null Het
Gm3573 T A 14: 42,188,472 T59S probably benign Het
Gm572 T C 4: 148,658,086 L94P possibly damaging Het
Gypa A T 8: 80,504,788 M109L probably benign Het
Hk3 C A 13: 55,011,352 V409L probably damaging Het
Kcnh6 A G 11: 106,009,099 T65A probably benign Het
Kdr G T 5: 75,944,545 P1055Q probably damaging Het
Lef1 T C 3: 131,200,404 probably null Het
Lrrc10 A G 10: 117,045,640 Q73R possibly damaging Het
Moxd1 C T 10: 24,279,850 T284I probably benign Het
Naf1 A T 8: 66,877,691 T290S possibly damaging Het
Naip5 C A 13: 100,245,929 V91L possibly damaging Het
Ncaph2 T C 15: 89,371,327 V568A probably damaging Het
Ntrk2 T C 13: 59,126,568 W753R probably damaging Het
Olfr621-ps1 C A 7: 103,629,825 C45F possibly damaging Het
Pbld1 C A 10: 63,067,433 N96K probably damaging Het
Pcdhac2 G A 18: 37,144,653 V229M probably benign Het
Prrc2b G T 2: 32,200,951 R445L probably benign Het
Scyl2 T C 10: 89,669,804 probably null Het
Sdf2l1 C G 16: 17,132,294 R6P probably benign Het
Slc22a5 A T 11: 53,871,616 I21N possibly damaging Het
Tmem168 A T 6: 13,582,838 F297L probably damaging Het
Trpm4 T C 7: 45,318,628 E293G possibly damaging Het
Trps1 T A 15: 50,822,563 T69S probably benign Het
Ubxn4 T C 1: 128,276,977 M468T probably benign Het
Unc5b C A 10: 60,780,232 R104L probably benign Het
Wfdc3 C T 2: 164,734,258 G38R possibly damaging Het
Wnt2b A G 3: 104,947,092 V350A probably benign Het
Zfp518b T C 5: 38,671,539 Q1041R probably damaging Het
Zranb1 T C 7: 132,949,745 F68L probably benign Het
Other mutations in Cchcr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00488:Cchcr1 APN 17 35528572 missense possibly damaging 0.92
IGL02723:Cchcr1 APN 17 35530802 missense probably benign 0.00
IGL02806:Cchcr1 APN 17 35525256 splice site probably benign
IGL03055:Cchcr1 UTSW 17 35526619 missense probably benign 0.33
R0569:Cchcr1 UTSW 17 35528968 critical splice donor site probably null
R1438:Cchcr1 UTSW 17 35530560 critical splice donor site probably null
R2055:Cchcr1 UTSW 17 35526420 missense probably damaging 1.00
R2511:Cchcr1 UTSW 17 35530513 missense probably benign 0.01
R3910:Cchcr1 UTSW 17 35525336 missense probably damaging 1.00
R3911:Cchcr1 UTSW 17 35525336 missense probably damaging 1.00
R3913:Cchcr1 UTSW 17 35525336 missense probably damaging 1.00
R5590:Cchcr1 UTSW 17 35526680 missense probably damaging 1.00
R5821:Cchcr1 UTSW 17 35528848 missense probably damaging 1.00
R5940:Cchcr1 UTSW 17 35524993 missense probably damaging 1.00
R5941:Cchcr1 UTSW 17 35524993 missense probably damaging 1.00
R6006:Cchcr1 UTSW 17 35524700 missense possibly damaging 0.83
R6114:Cchcr1 UTSW 17 35525330 missense probably damaging 0.98
R6146:Cchcr1 UTSW 17 35528578 missense possibly damaging 0.92
R6262:Cchcr1 UTSW 17 35530516 missense probably benign 0.04
R6369:Cchcr1 UTSW 17 35528176 missense probably damaging 0.99
R6478:Cchcr1 UTSW 17 35524703 missense possibly damaging 0.71
R6860:Cchcr1 UTSW 17 35529118 missense possibly damaging 0.85
R7109:Cchcr1 UTSW 17 35517941 critical splice donor site probably null
R7276:Cchcr1 UTSW 17 35529134 missense possibly damaging 0.46
X0025:Cchcr1 UTSW 17 35526676 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- TGGTTTCCTTGCGCCAGATC -3'
(R):5'- AAGGCCAGTGTATTCTACCTTTC -3'

Sequencing Primer
(F):5'- TTGCGCCAGATCCAGCAC -3'
(R):5'- TTCACAGATTCCTTGCACGAAG -3'
Posted On2018-09-12