Incidental Mutation 'R6828:2010300C02Rik'
ID534231
Institutional Source Beutler Lab
Gene Symbol 2010300C02Rik
Ensembl Gene ENSMUSG00000026090
Gene NameRIKEN cDNA 2010300C02 gene
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R6828 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location37611677-37720085 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37624817 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 667 (T667A)
Ref Sequence ENSEMBL: ENSMUSP00000123803 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000162875]
Predicted Effect
SMART Domains Protein: ENSMUSP00000125015
Gene: ENSMUSG00000026090
AA Change: T142A

DomainStartEndE-ValueType
internal_repeat_1 2 65 4.52e-24 PROSPERO
internal_repeat_1 65 128 4.52e-24 PROSPERO
low complexity region 181 194 N/A INTRINSIC
low complexity region 223 237 N/A INTRINSIC
low complexity region 263 279 N/A INTRINSIC
low complexity region 441 465 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000162875
AA Change: T667A

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000123803
Gene: ENSMUSG00000026090
AA Change: T667A

DomainStartEndE-ValueType
low complexity region 13 43 N/A INTRINSIC
Pfam:DUF4592 130 243 1.8e-33 PFAM
low complexity region 347 366 N/A INTRINSIC
internal_repeat_2 387 461 2.31e-5 PROSPERO
internal_repeat_3 404 474 3.67e-5 PROSPERO
internal_repeat_1 411 526 3.02e-34 PROSPERO
internal_repeat_2 485 559 2.31e-5 PROSPERO
internal_repeat_1 537 652 3.02e-34 PROSPERO
internal_repeat_3 570 698 3.67e-5 PROSPERO
low complexity region 705 718 N/A INTRINSIC
low complexity region 747 761 N/A INTRINSIC
low complexity region 787 803 N/A INTRINSIC
low complexity region 965 989 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 A T 17: 24,326,415 M349K possibly damaging Het
Akap12 A G 10: 4,354,606 E472G probably damaging Het
Ap2s1 T C 7: 16,748,701 Y94H probably damaging Het
Apeh A G 9: 108,087,038 F530L probably damaging Het
Aplnr G A 2: 85,139,759 probably benign Het
Arid3b A G 9: 57,810,163 probably null Het
Ash1l A C 3: 89,076,113 D2874A probably benign Het
Aurka T A 2: 172,357,252 R277S probably damaging Het
Ccar1 C A 10: 62,764,430 W574L probably damaging Het
Cd8b1 T C 6: 71,334,116 F207L probably benign Het
Clec14a T C 12: 58,268,504 R111G probably damaging Het
Clk3 G A 9: 57,760,849 T263I possibly damaging Het
Col11a2 A G 17: 34,053,633 probably null Het
Col5a3 C T 9: 20,798,452 G604D unknown Het
Crb2 ACTGCTGCTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 2: 37,776,409 probably benign Het
Ctps A T 4: 120,548,138 V369D probably damaging Het
Dennd5b A G 6: 148,993,746 I1262T probably damaging Het
Dmxl1 C T 18: 49,921,024 P2566S probably damaging Het
Fam170b A G 14: 32,835,958 D250G probably damaging Het
Fam26d A G 10: 34,043,957 F105L possibly damaging Het
Foxs1 G A 2: 152,933,128 Q2* probably null Het
Frmpd1 T C 4: 45,275,383 V512A probably damaging Het
Fry G A 5: 150,466,446 probably null Het
Gria1 A G 11: 57,289,462 Y677C probably damaging Het
Igdcc4 T C 9: 65,122,697 I343T probably benign Het
Igkv1-132 T C 6: 67,759,713 V5A probably benign Het
Ikzf5 A T 7: 131,391,672 C256S probably damaging Het
Itk G A 11: 46,341,218 H297Y probably damaging Het
Lamb3 A G 1: 193,335,448 E879G probably benign Het
Lpin2 T C 17: 71,222,128 V127A probably damaging Het
Man2b1 C A 8: 85,086,919 P247T possibly damaging Het
Mxd3 T C 13: 55,326,154 K122E probably benign Het
Npr1 C A 3: 90,464,813 V231L probably benign Het
Nsd2 C T 5: 33,893,568 A1263V probably damaging Het
Olfm4 A G 14: 80,021,533 D374G probably damaging Het
Olfr508 A C 7: 108,630,293 Q100H possibly damaging Het
Olfr803 A T 10: 129,691,994 S16T probably damaging Het
Optc A T 1: 133,897,867 I307N probably damaging Het
Pecr C A 1: 72,267,457 E222* probably null Het
Pibf1 A G 14: 99,186,551 N520S probably benign Het
Rhoj A G 12: 75,308,879 N19S probably benign Het
Rock2 G A 12: 16,942,959 probably null Het
Rpa1 G A 11: 75,314,871 T220I probably damaging Het
Sdf2l1 C G 16: 17,132,294 R6P probably benign Het
Sipa1l3 G A 7: 29,339,032 H397Y probably benign Het
Snrk T C 9: 122,137,566 I185T probably damaging Het
Srrt A T 5: 137,296,968 V300E probably damaging Het
Taok2 A T 7: 126,871,875 probably null Het
Tldc1 G A 8: 119,772,567 T62I possibly damaging Het
Tmem131 T C 1: 36,804,643 K1379R possibly damaging Het
Usp15 T C 10: 123,127,989 I543V probably damaging Het
Zfp553 A G 7: 127,236,275 E334G probably damaging Het
Zim1 T C 7: 6,677,689 Y325C probably damaging Het
Other mutations in 2010300C02Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01376:2010300C02Rik APN 1 37628344 missense probably damaging 0.99
IGL01413:2010300C02Rik APN 1 37612306 missense possibly damaging 0.85
IGL01812:2010300C02Rik APN 1 37625365 missense probably benign 0.06
IGL02183:2010300C02Rik APN 1 37625378 missense possibly damaging 0.93
IGL02498:2010300C02Rik APN 1 37623845 missense probably benign
IGL02713:2010300C02Rik APN 1 37624137 missense possibly damaging 0.72
IGL02736:2010300C02Rik APN 1 37637873 missense probably damaging 1.00
FR4449:2010300C02Rik UTSW 1 37625035 missense probably benign 0.40
FR4449:2010300C02Rik UTSW 1 37625036 nonsense probably null
FR4548:2010300C02Rik UTSW 1 37625035 missense probably benign 0.40
FR4548:2010300C02Rik UTSW 1 37625036 nonsense probably null
FR4548:2010300C02Rik UTSW 1 37625102 missense probably damaging 0.96
FR4737:2010300C02Rik UTSW 1 37625035 missense probably benign 0.40
FR4737:2010300C02Rik UTSW 1 37625036 nonsense probably null
FR4976:2010300C02Rik UTSW 1 37625035 missense probably benign 0.40
FR4976:2010300C02Rik UTSW 1 37625036 nonsense probably null
FR4976:2010300C02Rik UTSW 1 37625102 missense probably damaging 0.96
R0022:2010300C02Rik UTSW 1 37628245 missense probably damaging 1.00
R0022:2010300C02Rik UTSW 1 37628245 missense probably damaging 1.00
R0055:2010300C02Rik UTSW 1 37624256 missense probably benign 0.18
R0153:2010300C02Rik UTSW 1 37624639 missense probably benign
R0523:2010300C02Rik UTSW 1 37644629 start codon destroyed probably null 0.94
R0699:2010300C02Rik UTSW 1 37612330 missense possibly damaging 0.85
R0928:2010300C02Rik UTSW 1 37624582 missense possibly damaging 0.85
R1457:2010300C02Rik UTSW 1 37626012 nonsense probably null
R1759:2010300C02Rik UTSW 1 37625710 missense probably benign 0.00
R1888:2010300C02Rik UTSW 1 37624283 missense possibly damaging 0.53
R1888:2010300C02Rik UTSW 1 37624283 missense possibly damaging 0.53
R2289:2010300C02Rik UTSW 1 37612261 missense possibly damaging 0.53
R2421:2010300C02Rik UTSW 1 37613475 missense probably benign 0.33
R2422:2010300C02Rik UTSW 1 37613475 missense probably benign 0.33
R2509:2010300C02Rik UTSW 1 37625300 missense probably benign
R2510:2010300C02Rik UTSW 1 37625300 missense probably benign
R2511:2010300C02Rik UTSW 1 37625300 missense probably benign
R3893:2010300C02Rik UTSW 1 37631458 missense probably benign 0.00
R4351:2010300C02Rik UTSW 1 37624912 missense probably benign
R4454:2010300C02Rik UTSW 1 37624753 missense probably damaging 1.00
R4788:2010300C02Rik UTSW 1 37631475 missense probably damaging 1.00
R4798:2010300C02Rik UTSW 1 37624965 missense probably benign 0.12
R5599:2010300C02Rik UTSW 1 37613343 missense possibly damaging 0.53
R5920:2010300C02Rik UTSW 1 37637981 missense probably damaging 1.00
R6051:2010300C02Rik UTSW 1 37624225 missense probably damaging 0.98
R6106:2010300C02Rik UTSW 1 37613412 missense possibly damaging 0.53
R6794:2010300C02Rik UTSW 1 37637855 splice site probably null
R6930:2010300C02Rik UTSW 1 37624945 missense possibly damaging 0.73
X0025:2010300C02Rik UTSW 1 37624945 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- TGACCAAGGCCTTGTGCTTC -3'
(R):5'- AGAGACATGTCACCTCCCGAAG -3'

Sequencing Primer
(F):5'- CTTCAGGCAGCTCTTGGGTAC -3'
(R):5'- GATGTGGCACCTCCCAAGAAG -3'
Posted On2018-09-12