Incidental Mutation 'R6828:Ikzf5'
ID534255
Institutional Source Beutler Lab
Gene Symbol Ikzf5
Ensembl Gene ENSMUSG00000040167
Gene NameIKAROS family zinc finger 5
SynonymsZfpn1a5, 2610034F18Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.291) question?
Stock #R6828 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location131388652-131410521 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 131391672 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 256 (C256S)
Ref Sequence ENSEMBL: ENSMUSP00000113714 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046306] [ENSMUST00000075610] [ENSMUST00000121033] [ENSMUST00000124096] [ENSMUST00000128432] [ENSMUST00000145114] [ENSMUST00000154602] [ENSMUST00000207243]
Predicted Effect probably damaging
Transcript: ENSMUST00000046306
AA Change: C409S

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000035583
Gene: ENSMUSG00000040167
AA Change: C409S

DomainStartEndE-ValueType
ZnF_C2H2 82 104 3.58e-2 SMART
ZnF_C2H2 110 132 1.53e-1 SMART
ZnF_C2H2 138 161 1.79e-2 SMART
low complexity region 289 320 N/A INTRINSIC
ZnF_C2H2 364 386 8.09e0 SMART
ZnF_C2H2 392 416 9.22e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000075610
SMART Domains Protein: ENSMUSP00000075037
Gene: ENSMUSG00000063179

DomainStartEndE-ValueType
low complexity region 3 12 N/A INTRINSIC
Pfam:AAA_33 20 213 2.7e-11 PFAM
Pfam:KTI12 136 345 3.7e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000121033
AA Change: C256S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113714
Gene: ENSMUSG00000040167
AA Change: C256S

DomainStartEndE-ValueType
ZnF_C2H2 82 104 3.58e-2 SMART
low complexity region 136 167 N/A INTRINSIC
ZnF_C2H2 211 233 8.09e0 SMART
ZnF_C2H2 239 263 9.22e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124096
SMART Domains Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
Pfam:Pkinase 1 118 4.8e-19 PFAM
Pfam:Pkinase_Tyr 1 118 1.7e-50 PFAM
low complexity region 146 160 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128092
Predicted Effect probably benign
Transcript: ENSMUST00000128432
SMART Domains Protein: ENSMUSP00000139528
Gene: ENSMUSG00000040167

DomainStartEndE-ValueType
ZnF_C2H2 82 104 1.5e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000133284
Predicted Effect probably benign
Transcript: ENSMUST00000145114
SMART Domains Protein: ENSMUSP00000118636
Gene: ENSMUSG00000063179

DomainStartEndE-ValueType
low complexity region 3 12 N/A INTRINSIC
Pfam:KTI12 18 88 5.6e-8 PFAM
Pfam:AAA_17 20 212 3.2e-8 PFAM
Pfam:AAA_33 20 213 2.2e-13 PFAM
Pfam:KTI12 136 265 1.6e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154602
SMART Domains Protein: ENSMUSP00000123530
Gene: ENSMUSG00000040167

DomainStartEndE-ValueType
ZnF_C2H2 82 104 3.58e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000207243
Predicted Effect probably benign
Transcript: ENSMUST00000207489
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the Ikaros (ZNFN1A1; MIM 603023) family of transcription factors, which includes Pegasus, are expressed in lymphocytes and are implicated in the control of lymphoid development.[supplied by OMIM, Jul 2002]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik T C 1: 37,624,817 T667A possibly damaging Het
Abca17 A T 17: 24,326,415 M349K possibly damaging Het
Akap12 A G 10: 4,354,606 E472G probably damaging Het
Ap2s1 T C 7: 16,748,701 Y94H probably damaging Het
Apeh A G 9: 108,087,038 F530L probably damaging Het
Aplnr G A 2: 85,139,759 probably benign Het
Arid3b A G 9: 57,810,163 probably null Het
Ash1l A C 3: 89,076,113 D2874A probably benign Het
Aurka T A 2: 172,357,252 R277S probably damaging Het
Ccar1 C A 10: 62,764,430 W574L probably damaging Het
Cd8b1 T C 6: 71,334,116 F207L probably benign Het
Clec14a T C 12: 58,268,504 R111G probably damaging Het
Clk3 G A 9: 57,760,849 T263I possibly damaging Het
Col11a2 A G 17: 34,053,633 probably null Het
Col5a3 C T 9: 20,798,452 G604D unknown Het
Crb2 ACTGCTGCTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 2: 37,776,409 probably benign Het
Ctps A T 4: 120,548,138 V369D probably damaging Het
Dennd5b A G 6: 148,993,746 I1262T probably damaging Het
Dmxl1 C T 18: 49,921,024 P2566S probably damaging Het
Fam170b A G 14: 32,835,958 D250G probably damaging Het
Fam26d A G 10: 34,043,957 F105L possibly damaging Het
Foxs1 G A 2: 152,933,128 Q2* probably null Het
Frmpd1 T C 4: 45,275,383 V512A probably damaging Het
Fry G A 5: 150,466,446 probably null Het
Gria1 A G 11: 57,289,462 Y677C probably damaging Het
Igdcc4 T C 9: 65,122,697 I343T probably benign Het
Igkv1-132 T C 6: 67,759,713 V5A probably benign Het
Itk G A 11: 46,341,218 H297Y probably damaging Het
Lamb3 A G 1: 193,335,448 E879G probably benign Het
Lpin2 T C 17: 71,222,128 V127A probably damaging Het
Man2b1 C A 8: 85,086,919 P247T possibly damaging Het
Mxd3 T C 13: 55,326,154 K122E probably benign Het
Npr1 C A 3: 90,464,813 V231L probably benign Het
Nsd2 C T 5: 33,893,568 A1263V probably damaging Het
Olfm4 A G 14: 80,021,533 D374G probably damaging Het
Olfr508 A C 7: 108,630,293 Q100H possibly damaging Het
Olfr803 A T 10: 129,691,994 S16T probably damaging Het
Optc A T 1: 133,897,867 I307N probably damaging Het
Pecr C A 1: 72,267,457 E222* probably null Het
Pibf1 A G 14: 99,186,551 N520S probably benign Het
Rhoj A G 12: 75,308,879 N19S probably benign Het
Rock2 G A 12: 16,942,959 probably null Het
Rpa1 G A 11: 75,314,871 T220I probably damaging Het
Sdf2l1 C G 16: 17,132,294 R6P probably benign Het
Sipa1l3 G A 7: 29,339,032 H397Y probably benign Het
Snrk T C 9: 122,137,566 I185T probably damaging Het
Srrt A T 5: 137,296,968 V300E probably damaging Het
Taok2 A T 7: 126,871,875 probably null Het
Tldc1 G A 8: 119,772,567 T62I possibly damaging Het
Tmem131 T C 1: 36,804,643 K1379R possibly damaging Het
Usp15 T C 10: 123,127,989 I543V probably damaging Het
Zfp553 A G 7: 127,236,275 E334G probably damaging Het
Zim1 T C 7: 6,677,689 Y325C probably damaging Het
Other mutations in Ikzf5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03149:Ikzf5 APN 7 131396765 missense probably damaging 1.00
R0545:Ikzf5 UTSW 7 131392500 missense possibly damaging 0.87
R0583:Ikzf5 UTSW 7 131391785 unclassified probably null
R1471:Ikzf5 UTSW 7 131391767 missense probably damaging 1.00
R2680:Ikzf5 UTSW 7 131396761 missense probably damaging 1.00
R4496:Ikzf5 UTSW 7 131396664 unclassified probably null
R4625:Ikzf5 UTSW 7 131393753 critical splice donor site probably null
R6307:Ikzf5 UTSW 7 131391648 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCCTGGGAATCCTTATGGAC -3'
(R):5'- GTACTCCCAGCATAGGAAACAG -3'

Sequencing Primer
(F):5'- CCCTGGGAATCCTTATGGACAAGTG -3'
(R):5'- GCATAGGAAACAGCCAGCCAAG -3'
Posted On2018-09-12