Incidental Mutation 'R6828:Olfm4'
ID534277
Institutional Source Beutler Lab
Gene Symbol Olfm4
Ensembl Gene ENSMUSG00000022026
Gene Nameolfactomedin 4
SynonymsGW112, OlfD, pPD4, GC1, LOC239192, LOC380924
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R6828 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location79984081-80023139 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 80021533 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 374 (D374G)
Ref Sequence ENSEMBL: ENSMUSP00000154285 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088735] [ENSMUST00000228749]
Predicted Effect probably damaging
Transcript: ENSMUST00000088735
AA Change: D407G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000086112
Gene: ENSMUSG00000022026
AA Change: D407G

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 32 43 N/A INTRINSIC
low complexity region 225 243 N/A INTRINSIC
OLF 274 532 8.53e-72 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000228749
AA Change: D374G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was originally cloned from human myeloblasts and found to be selectively expressed in inflammed colonic epithelium. This gene encodes a member of the olfactomedin family. The encoded protein is an antiapoptotic factor that promotes tumor growth and is an extracellular matrix glycoprotein that facilitates cell adhesion. [provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced colonization of the gastric mucosa by Helicobacter pylori but increased inflammatory response to H. pylori infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik T C 1: 37,624,817 T667A possibly damaging Het
Abca17 A T 17: 24,326,415 M349K possibly damaging Het
Akap12 A G 10: 4,354,606 E472G probably damaging Het
Ap2s1 T C 7: 16,748,701 Y94H probably damaging Het
Apeh A G 9: 108,087,038 F530L probably damaging Het
Aplnr G A 2: 85,139,759 probably benign Het
Arid3b A G 9: 57,810,163 probably null Het
Ash1l A C 3: 89,076,113 D2874A probably benign Het
Aurka T A 2: 172,357,252 R277S probably damaging Het
Ccar1 C A 10: 62,764,430 W574L probably damaging Het
Cd8b1 T C 6: 71,334,116 F207L probably benign Het
Clec14a T C 12: 58,268,504 R111G probably damaging Het
Clk3 G A 9: 57,760,849 T263I possibly damaging Het
Col11a2 A G 17: 34,053,633 probably null Het
Col5a3 C T 9: 20,798,452 G604D unknown Het
Crb2 ACTGCTGCTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 2: 37,776,409 probably benign Het
Ctps A T 4: 120,548,138 V369D probably damaging Het
Dennd5b A G 6: 148,993,746 I1262T probably damaging Het
Dmxl1 C T 18: 49,921,024 P2566S probably damaging Het
Fam170b A G 14: 32,835,958 D250G probably damaging Het
Fam26d A G 10: 34,043,957 F105L possibly damaging Het
Foxs1 G A 2: 152,933,128 Q2* probably null Het
Frmpd1 T C 4: 45,275,383 V512A probably damaging Het
Fry G A 5: 150,466,446 probably null Het
Gria1 A G 11: 57,289,462 Y677C probably damaging Het
Igdcc4 T C 9: 65,122,697 I343T probably benign Het
Igkv1-132 T C 6: 67,759,713 V5A probably benign Het
Ikzf5 A T 7: 131,391,672 C256S probably damaging Het
Itk G A 11: 46,341,218 H297Y probably damaging Het
Lamb3 A G 1: 193,335,448 E879G probably benign Het
Lpin2 T C 17: 71,222,128 V127A probably damaging Het
Man2b1 C A 8: 85,086,919 P247T possibly damaging Het
Mxd3 T C 13: 55,326,154 K122E probably benign Het
Npr1 C A 3: 90,464,813 V231L probably benign Het
Nsd2 C T 5: 33,893,568 A1263V probably damaging Het
Olfr508 A C 7: 108,630,293 Q100H possibly damaging Het
Olfr803 A T 10: 129,691,994 S16T probably damaging Het
Optc A T 1: 133,897,867 I307N probably damaging Het
Pecr C A 1: 72,267,457 E222* probably null Het
Pibf1 A G 14: 99,186,551 N520S probably benign Het
Rhoj A G 12: 75,308,879 N19S probably benign Het
Rock2 G A 12: 16,942,959 probably null Het
Rpa1 G A 11: 75,314,871 T220I probably damaging Het
Sdf2l1 C G 16: 17,132,294 R6P probably benign Het
Sipa1l3 G A 7: 29,339,032 H397Y probably benign Het
Snrk T C 9: 122,137,566 I185T probably damaging Het
Srrt A T 5: 137,296,968 V300E probably damaging Het
Taok2 A T 7: 126,871,875 probably null Het
Tldc1 G A 8: 119,772,567 T62I possibly damaging Het
Tmem131 T C 1: 36,804,643 K1379R possibly damaging Het
Usp15 T C 10: 123,127,989 I543V probably damaging Het
Zfp553 A G 7: 127,236,275 E334G probably damaging Het
Zim1 T C 7: 6,677,689 Y325C probably damaging Het
Other mutations in Olfm4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00532:Olfm4 APN 14 80021143 missense probably benign 0.12
IGL01108:Olfm4 APN 14 80021899 missense probably benign 0.15
IGL01599:Olfm4 APN 14 80021310 missense probably damaging 1.00
IGL01872:Olfm4 APN 14 80021928 makesense probably null
IGL01928:Olfm4 APN 14 80011952 missense possibly damaging 0.71
IGL02333:Olfm4 APN 14 80021770 missense probably damaging 1.00
IGL02336:Olfm4 APN 14 80006321 missense probably damaging 1.00
IGL02811:Olfm4 APN 14 80021673 missense probably damaging 1.00
PIT4651001:Olfm4 UTSW 14 80021485 missense probably benign 0.00
R1428:Olfm4 UTSW 14 80021403 missense probably damaging 1.00
R1649:Olfm4 UTSW 14 80011982 missense probably damaging 0.98
R2139:Olfm4 UTSW 14 80014315 missense probably benign 0.00
R2270:Olfm4 UTSW 14 80011875 missense probably damaging 0.96
R2401:Olfm4 UTSW 14 80021752 missense probably damaging 1.00
R4527:Olfm4 UTSW 14 80021224 missense probably benign 0.13
R4649:Olfm4 UTSW 14 80021307 missense probably benign 0.00
R5232:Olfm4 UTSW 14 80021682 missense probably damaging 1.00
R5512:Olfm4 UTSW 14 80021347 missense probably benign 0.32
R6198:Olfm4 UTSW 14 80000373 missense probably benign 0.18
R6642:Olfm4 UTSW 14 80021667 missense probably damaging 1.00
R6916:Olfm4 UTSW 14 80014198 missense probably damaging 0.97
R6960:Olfm4 UTSW 14 80021314 missense probably damaging 0.97
R7329:Olfm4 UTSW 14 80011929 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- ACAGACTTTACGACTCATTGGAC -3'
(R):5'- CCACATACCATGAAGGCATTCG -3'

Sequencing Primer
(F):5'- ACTATCGGATTCGCTATGGCCAAG -3'
(R):5'- TCGAAACAGATGGCTTGTACTGC -3'
Posted On2018-09-12