Incidental Mutation 'R6830:Zfp84'
ID534348
Institutional Source Beutler Lab
Gene Symbol Zfp84
Ensembl Gene ENSMUSG00000046185
Gene Namezinc finger protein 84
SynonymsC86188, 4633401C23Rik, Zfp69, KRAB18, 2210410P13Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6830 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location29768552-29779821 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 29776486 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 201 (Y201C)
Ref Sequence ENSEMBL: ENSMUSP00000032802 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032802]
Predicted Effect probably benign
Transcript: ENSMUST00000032802
AA Change: Y201C

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000032802
Gene: ENSMUSG00000046185
AA Change: Y201C

DomainStartEndE-ValueType
KRAB 14 74 9.09e-36 SMART
ZnF_C2H2 249 271 1.67e-2 SMART
ZnF_C2H2 277 299 1.43e-1 SMART
ZnF_C2H2 305 327 5.81e-2 SMART
ZnF_C2H2 333 355 1.95e-3 SMART
ZnF_C2H2 361 383 8.6e-5 SMART
ZnF_C2H2 389 411 2.32e-1 SMART
ZnF_C2H2 417 439 3.89e-3 SMART
ZnF_C2H2 445 467 1.69e-3 SMART
ZnF_C2H2 473 495 9.58e-3 SMART
ZnF_C2H2 501 523 1.38e-3 SMART
ZnF_C2H2 529 551 1.58e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 98% (53/54)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,176,184 S135P probably benign Het
4930503B20Rik T C 3: 146,650,961 D64G possibly damaging Het
Amtn T C 5: 88,378,097 L40P probably damaging Het
Ano6 A G 15: 95,894,461 R90G probably damaging Het
Arfgef3 A C 10: 18,664,889 probably null Het
Asxl3 C T 18: 22,525,388 P2152S probably benign Het
Atp7b A T 8: 22,022,365 V494E probably damaging Het
Bik T A 15: 83,544,208 Y146N probably benign Het
C1qtnf7 A T 5: 43,609,094 I12F possibly damaging Het
Cacna1e A G 1: 154,413,974 probably null Het
Ccnj A G 19: 40,845,192 E231G probably damaging Het
Cd101 T C 3: 100,993,696 K1020R probably benign Het
Cdh6 C A 15: 13,044,774 V421L probably benign Het
Decr1 T C 4: 15,924,355 probably null Het
Dmxl1 C T 18: 49,921,024 P2566S probably damaging Het
Dock9 G A 14: 121,622,918 P866L probably damaging Het
Epx A G 11: 87,868,626 F546L probably damaging Het
Fat4 T A 3: 38,981,817 M3206K probably benign Het
Fgb T C 3: 83,045,025 D179G probably benign Het
Gbgt1 A G 2: 28,505,208 D286G probably damaging Het
Gm8251 A G 1: 44,056,730 V1736A probably benign Het
Gpn1 T A 5: 31,507,488 S285R probably benign Het
Htt T A 5: 34,834,326 Y1212N possibly damaging Het
Kcnj13 T C 1: 87,387,023 K159R probably damaging Het
Ldb2 T A 5: 44,541,857 I80F probably damaging Het
Macrod2 T A 2: 140,452,682 N89K probably damaging Het
Mdga2 G A 12: 66,723,001 R173C probably damaging Het
Mroh9 A G 1: 163,076,366 F26L probably benign Het
Neil3 G T 8: 53,599,479 N361K probably benign Het
Nepro A G 16: 44,731,357 R193G probably damaging Het
Olfr653 T A 7: 104,580,240 I198N probably damaging Het
Pclo A T 5: 14,681,099 Q3205L unknown Het
Plekhm1 A T 11: 103,376,889 I752N probably damaging Het
Podn T C 4: 108,021,417 T273A possibly damaging Het
Prep T A 10: 45,097,501 M235K probably benign Het
Ptprc A T 1: 138,072,255 probably null Het
Reg2 A G 6: 78,407,642 H119R possibly damaging Het
Rpe65 T C 3: 159,614,168 V225A probably benign Het
Scn9a T C 2: 66,568,029 D79G probably damaging Het
Slc25a23 G A 17: 57,053,804 R9* probably null Het
Snai3 A G 8: 122,456,473 L111P probably damaging Het
Stk38 A G 17: 29,000,007 probably null Het
Stk38l A T 6: 146,766,771 I115F possibly damaging Het
Tmco6 T A 18: 36,738,353 probably null Het
Tollip A T 7: 141,898,714 M1K probably null Het
Trim40 T C 17: 36,888,850 Y112C possibly damaging Het
Ttc27 T A 17: 74,856,555 Y719* probably null Het
Ubald1 T C 16: 4,879,720 D6G probably damaging Het
Vmn2r59 A T 7: 42,043,747 S476R probably benign Het
Wfdc3 C T 2: 164,734,258 G38R possibly damaging Het
Zbtb21 C T 16: 97,951,961 G402D probably damaging Het
Zswim2 T A 2: 83,939,684 H62L probably damaging Het
Other mutations in Zfp84
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01768:Zfp84 APN 7 29776666 missense probably benign 0.16
IGL03022:Zfp84 APN 7 29775334 splice site probably benign
R0666:Zfp84 UTSW 7 29776851 missense probably damaging 1.00
R0781:Zfp84 UTSW 7 29771372 start codon destroyed probably null 0.02
R1110:Zfp84 UTSW 7 29771372 start codon destroyed probably null 0.02
R1353:Zfp84 UTSW 7 29776175 missense probably benign 0.02
R1495:Zfp84 UTSW 7 29777303 nonsense probably null
R1496:Zfp84 UTSW 7 29776614 missense possibly damaging 0.53
R1681:Zfp84 UTSW 7 29777400 missense probably damaging 1.00
R1827:Zfp84 UTSW 7 29777343 missense possibly damaging 0.91
R1854:Zfp84 UTSW 7 29775371 missense possibly damaging 0.84
R2209:Zfp84 UTSW 7 29777182 missense probably damaging 0.99
R2843:Zfp84 UTSW 7 29775333 splice site probably null
R2844:Zfp84 UTSW 7 29775333 splice site probably null
R4691:Zfp84 UTSW 7 29777080 missense probably damaging 1.00
R5453:Zfp84 UTSW 7 29776297 missense possibly damaging 0.82
R5474:Zfp84 UTSW 7 29777089 missense probably damaging 1.00
R5578:Zfp84 UTSW 7 29775431 missense possibly damaging 0.93
R5646:Zfp84 UTSW 7 29776393 missense probably benign 0.05
R5963:Zfp84 UTSW 7 29776953 missense probably damaging 1.00
V3553:Zfp84 UTSW 7 29777247 missense probably benign 0.36
Predicted Primers PCR Primer
(F):5'- GGACTCCTTGAGACAAAACGGG -3'
(R):5'- AAGGTAAGCGTGCTTCTCAAAG -3'

Sequencing Primer
(F):5'- TCCTTGAGACAAAACGGGAATCTAC -3'
(R):5'- AAGCGTGCTTCTCAAAGATCTTGC -3'
Posted On2018-09-12