Incidental Mutation 'R6835:Rtel1'
ID534381
Institutional Source Beutler Lab
Gene Symbol Rtel1
Ensembl Gene ENSMUSG00000038685
Gene Nameregulator of telomere elongation helicase 1
SynonymsNhl, Rtel, KIAA1088, C20ORF41
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_001001882.3, NM_001166665.1, NM_001166666.1, NM_001166667.1, NM_001166668.1; MGI: 2139369

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6835 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location181319739-181356616 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 181355953 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 1165 (T1165A)
Ref Sequence ENSEMBL: ENSMUSP00000053120 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048608] [ENSMUST00000054622] [ENSMUST00000098971] [ENSMUST00000108808] [ENSMUST00000108814] [ENSMUST00000108815] [ENSMUST00000127988] [ENSMUST00000148252] [ENSMUST00000170190] [ENSMUST00000183499] [ENSMUST00000185118]
Predicted Effect probably benign
Transcript: ENSMUST00000048608
AA Change: T1084A

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000043563
Gene: ENSMUSG00000038685
AA Change: T1084A

DomainStartEndE-ValueType
DEXDc 13 292 9.88e-3 SMART
HELICc 563 717 1.07e-62 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000054622
AA Change: T1165A

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000053120
Gene: ENSMUSG00000038685
AA Change: T1165A

DomainStartEndE-ValueType
DEXDc 13 292 9.88e-3 SMART
HELICc 563 717 1.07e-62 SMART
low complexity region 1075 1092 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098971
AA Change: T1126A

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000096571
Gene: ENSMUSG00000038685
AA Change: T1126A

DomainStartEndE-ValueType
DEXDc 13 292 9.88e-3 SMART
HELICc 563 717 1.07e-62 SMART
low complexity region 1036 1053 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108808
SMART Domains Protein: ENSMUSP00000104436
Gene: ENSMUSG00000038671

DomainStartEndE-ValueType
ARF 1 191 1.71e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108814
AA Change: T1159A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000104442
Gene: ENSMUSG00000038685
AA Change: T1159A

DomainStartEndE-ValueType
DEXDc 13 292 9.88e-3 SMART
HELICc 563 717 1.07e-62 SMART
low complexity region 1069 1086 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108815
AA Change: T1120A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000104443
Gene: ENSMUSG00000038685
AA Change: T1120A

DomainStartEndE-ValueType
DEXDc 13 292 9.88e-3 SMART
HELICc 563 717 1.07e-62 SMART
low complexity region 1030 1047 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127988
SMART Domains Protein: ENSMUSP00000122066
Gene: ENSMUSG00000038671

DomainStartEndE-ValueType
ARF 1 191 1.71e-31 SMART
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000134651
Predicted Effect probably benign
Transcript: ENSMUST00000137700
Predicted Effect probably benign
Transcript: ENSMUST00000148252
AA Change: T948A

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000116159
Gene: ENSMUSG00000038685
AA Change: T948A

DomainStartEndE-ValueType
Pfam:DEAD_2 1 88 1.3e-33 PFAM
HELICc 379 533 1.07e-62 SMART
low complexity region 858 875 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170190
SMART Domains Protein: ENSMUSP00000126387
Gene: ENSMUSG00000038671

DomainStartEndE-ValueType
Pfam:Miro 1 90 1.2e-9 PFAM
Pfam:Arf 1 140 8.5e-38 PFAM
Pfam:Gtr1_RagA 2 110 2.2e-6 PFAM
Pfam:SRPRB 4 118 6e-8 PFAM
Pfam:Ras 4 142 2.7e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000183499
SMART Domains Protein: ENSMUSP00000138941
Gene: ENSMUSG00000038671

DomainStartEndE-ValueType
Pfam:Arf 4 61 4.8e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000185118
SMART Domains Protein: ENSMUSP00000139211
Gene: ENSMUSG00000038671

DomainStartEndE-ValueType
Pfam:Arf 4 120 1.6e-30 PFAM
Pfam:SRPRB 15 116 6.6e-8 PFAM
Pfam:Ras 19 116 2.1e-9 PFAM
Pfam:Miro 19 117 7.3e-12 PFAM
Pfam:MMR_HSR1 19 117 1.2e-7 PFAM
Pfam:Gtr1_RagA 19 119 5.5e-9 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 100% (44/44)
MGI Phenotype Strain: 3772371; 3052235
Lethality: E11-E12
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA helicase which functions in the stability, protection and elongation of telomeres and interacts with proteins in the shelterin complex known to protect telomeres during DNA replication. Mutations in this gene have been associated with dyskeratosis congenita and Hoyerall-Hreidarsson syndrome. Read-through transcription of this gene into the neighboring downstream gene, which encodes tumor necrosis factor receptor superfamily, member 6b, generates a non-coding transcript. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2013]
PHENOTYPE: Homozygous null mice display embryonic lethality with abnormal development of the neural tube, brain, heart, vasculature, placenta, and allantois and chromosomal abnormalities in differentiating cells. [provided by MGI curators]
Allele List at MGI

All alleles(33) : Targeted(5) Gene trapped(28)

Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl11 A G 9: 107,930,562 R695G probably benign Het
Arhgef4 A G 1: 34,806,493 H1533R probably damaging Het
Birc6 T C 17: 74,642,504 L3120P probably damaging Het
Cfap46 T A 7: 139,652,498 I850F probably damaging Het
Crym A C 7: 120,186,645 S311A probably benign Het
Cttn T C 7: 144,456,497 probably null Het
Dtnb C T 12: 3,632,841 probably benign Het
Edem1 T C 6: 108,854,399 V607A probably benign Het
Etfa A G 9: 55,495,819 V64A probably benign Het
Fam133b A G 5: 3,554,732 T40A possibly damaging Het
Fmn2 C A 1: 174,699,669 D1442E probably damaging Het
Gpi1 T C 7: 34,227,138 K128E possibly damaging Het
Gpr179 A T 11: 97,347,467 F310L probably damaging Het
Hdac7 T A 15: 97,802,747 H531L probably damaging Het
Hfm1 G A 5: 106,878,815 R145* probably null Het
Hsp90b1 A T 10: 86,694,085 D573E probably damaging Het
Hunk T G 16: 90,472,524 W243G probably damaging Het
Icam1 G T 9: 21,027,125 G327W possibly damaging Het
Ino80d C A 1: 63,074,326 A322S probably benign Het
Itpkc A C 7: 27,227,815 S225A probably benign Het
Krt75 C T 15: 101,571,037 R286Q probably benign Het
Lmnb2 A G 10: 80,909,960 L95P probably damaging Het
Mns1 T C 9: 72,452,744 M392T probably damaging Het
Morc3 A T 16: 93,847,421 N200I probably damaging Het
Mrvi1 T G 7: 110,921,334 E278A probably damaging Het
Myadm T C 7: 3,297,676 V318A possibly damaging Het
Nt5dc1 A C 10: 34,310,379 S398A probably benign Het
Olfr155 T C 4: 43,854,912 V201A probably benign Het
Olfr391-ps A G 11: 73,799,235 I174T possibly damaging Het
Pcdhga2 T C 18: 37,670,789 I562T probably damaging Het
Pcdhgb1 T A 18: 37,680,500 C15S probably benign Het
Pikfyve T G 1: 65,258,843 L1532R probably damaging Het
Rdh7 T A 10: 127,884,739 T255S probably benign Het
Sdk2 C T 11: 113,830,048 A1352T probably damaging Het
Strip2 T C 6: 29,941,917 S629P probably damaging Het
Taf5 A G 19: 47,077,337 T494A possibly damaging Het
Tek T G 4: 94,853,434 N809K possibly damaging Het
Tmbim7 A T 5: 3,661,943 T63S probably benign Het
Utrn A T 10: 12,727,764 L624Q probably damaging Het
Xbp1 A G 11: 5,521,809 probably benign Het
Zbp1 T A 2: 173,213,911 probably null Het
Zfp112 T C 7: 24,125,806 C400R probably damaging Het
Zfp202 C T 9: 40,210,235 probably null Het
Zfp747 T C 7: 127,374,047 E317G possibly damaging Het
Other mutations in Rtel1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01420:Rtel1 APN 2 181354401 missense probably benign 0.16
IGL01957:Rtel1 APN 2 181349313 unclassified probably benign
IGL02247:Rtel1 APN 2 181351341 nonsense probably null
IGL02414:Rtel1 APN 2 181335972 missense probably benign 0.01
IGL02448:Rtel1 APN 2 181336037 missense probably benign 0.00
IGL03053:Rtel1 APN 2 181351944 missense probably benign 0.02
IGL03059:Rtel1 APN 2 181350183 missense probably benign 0.01
IGL03326:Rtel1 APN 2 181355561 unclassified probably benign
PIT4283001:Rtel1 UTSW 2 181346890 missense probably benign 0.00
R0047:Rtel1 UTSW 2 181323405 missense probably damaging 1.00
R0047:Rtel1 UTSW 2 181323405 missense probably damaging 1.00
R0051:Rtel1 UTSW 2 181350656 nonsense probably null
R0051:Rtel1 UTSW 2 181350656 nonsense probably null
R0147:Rtel1 UTSW 2 181321046 missense probably damaging 1.00
R0148:Rtel1 UTSW 2 181321046 missense probably damaging 1.00
R0316:Rtel1 UTSW 2 181356002 missense possibly damaging 0.87
R0628:Rtel1 UTSW 2 181351881 missense probably benign 0.03
R0940:Rtel1 UTSW 2 181322803 missense probably benign 0.36
R1165:Rtel1 UTSW 2 181334939 missense probably benign 0.26
R1213:Rtel1 UTSW 2 181351335 missense probably benign 0.01
R1291:Rtel1 UTSW 2 181351043 missense probably damaging 1.00
R1353:Rtel1 UTSW 2 181349231 missense probably benign
R1398:Rtel1 UTSW 2 181335865 intron probably null
R1796:Rtel1 UTSW 2 181352103 missense probably benign 0.01
R1973:Rtel1 UTSW 2 181351626 missense probably benign 0.04
R2033:Rtel1 UTSW 2 181351863 nonsense probably null
R2144:Rtel1 UTSW 2 181323706 missense probably damaging 0.97
R2265:Rtel1 UTSW 2 181354368 missense probably damaging 1.00
R2269:Rtel1 UTSW 2 181336003 missense probably benign 0.00
R2416:Rtel1 UTSW 2 181340531 missense possibly damaging 0.66
R2865:Rtel1 UTSW 2 181349972 missense probably benign 0.36
R3508:Rtel1 UTSW 2 181322409 missense probably benign 0.32
R4242:Rtel1 UTSW 2 181349934 missense probably damaging 1.00
R4377:Rtel1 UTSW 2 181355796 missense probably damaging 1.00
R4702:Rtel1 UTSW 2 181352169 missense probably benign 0.30
R4706:Rtel1 UTSW 2 181323746 critical splice donor site probably null
R4817:Rtel1 UTSW 2 181355935 missense possibly damaging 0.82
R5020:Rtel1 UTSW 2 181322514 splice site probably null
R5069:Rtel1 UTSW 2 181355492 missense probably benign 0.03
R5222:Rtel1 UTSW 2 181346983 intron probably benign
R5268:Rtel1 UTSW 2 181340561 missense probably benign 0.03
R5291:Rtel1 UTSW 2 181352095 missense possibly damaging 0.47
R5588:Rtel1 UTSW 2 181352100 missense probably benign
R5682:Rtel1 UTSW 2 181349972 missense probably benign 0.19
R5796:Rtel1 UTSW 2 181340506 missense probably benign 0.26
R5931:Rtel1 UTSW 2 181330815 nonsense probably null
R6249:Rtel1 UTSW 2 181351682 missense probably damaging 1.00
R6465:Rtel1 UTSW 2 181335940 missense possibly damaging 0.68
R6616:Rtel1 UTSW 2 181352786 missense possibly damaging 0.68
R6800:Rtel1 UTSW 2 181322463 missense probably benign 0.31
R6917:Rtel1 UTSW 2 181338277 makesense probably null
R7264:Rtel1 UTSW 2 181351861 missense not run
R7381:Rtel1 UTSW 2 181330815 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAGGACTTGGAGCTCGAAGGTC -3'
(R):5'- CACACTGTTCAGTGCCCTAC -3'

Sequencing Primer
(F):5'- ATGAGAGCCCAACTGTGC -3'
(R):5'- ACTGTTCAGTGCCCTACCATAAC -3'
Posted On2018-09-12