Incidental Mutation 'R6835:Olfr155'
ID534382
Institutional Source Beutler Lab
Gene Symbol Olfr155
Ensembl Gene ENSMUSG00000071000
Gene Nameolfactory receptor 155
SynonymsOR37A, Olfr37a, GA_x6K02T2N78B-16092200-16091241, mOR37a, MOR262-14
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R6835 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location43851565-43857595 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 43854912 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 201 (V201A)
Ref Sequence ENSEMBL: ENSMUSP00000103492 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095108] [ENSMUST00000107860]
Predicted Effect probably benign
Transcript: ENSMUST00000095108
AA Change: V201A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000092726
Gene: ENSMUSG00000071000
AA Change: V201A

DomainStartEndE-ValueType
Pfam:7tm_1 42 297 2.8e-35 PFAM
Pfam:7tm_4 140 290 1.4e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107860
AA Change: V201A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000103492
Gene: ENSMUSG00000071000
AA Change: V201A

DomainStartEndE-ValueType
Pfam:7tm_4 32 315 9.7e-59 PFAM
Pfam:7tm_1 42 297 3.5e-25 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl11 A G 9: 107,930,562 R695G probably benign Het
Arhgef4 A G 1: 34,806,493 H1533R probably damaging Het
Birc6 T C 17: 74,642,504 L3120P probably damaging Het
Cfap46 T A 7: 139,652,498 I850F probably damaging Het
Crym A C 7: 120,186,645 S311A probably benign Het
Cttn T C 7: 144,456,497 probably null Het
Dtnb C T 12: 3,632,841 probably benign Het
Edem1 T C 6: 108,854,399 V607A probably benign Het
Etfa A G 9: 55,495,819 V64A probably benign Het
Fam133b A G 5: 3,554,732 T40A possibly damaging Het
Fmn2 C A 1: 174,699,669 D1442E probably damaging Het
Gpi1 T C 7: 34,227,138 K128E possibly damaging Het
Gpr179 A T 11: 97,347,467 F310L probably damaging Het
Hdac7 T A 15: 97,802,747 H531L probably damaging Het
Hfm1 G A 5: 106,878,815 R145* probably null Het
Hsp90b1 A T 10: 86,694,085 D573E probably damaging Het
Hunk T G 16: 90,472,524 W243G probably damaging Het
Icam1 G T 9: 21,027,125 G327W possibly damaging Het
Ino80d C A 1: 63,074,326 A322S probably benign Het
Itpkc A C 7: 27,227,815 S225A probably benign Het
Krt75 C T 15: 101,571,037 R286Q probably benign Het
Lmnb2 A G 10: 80,909,960 L95P probably damaging Het
Mns1 T C 9: 72,452,744 M392T probably damaging Het
Morc3 A T 16: 93,847,421 N200I probably damaging Het
Mrvi1 T G 7: 110,921,334 E278A probably damaging Het
Myadm T C 7: 3,297,676 V318A possibly damaging Het
Nt5dc1 A C 10: 34,310,379 S398A probably benign Het
Olfr391-ps A G 11: 73,799,235 I174T possibly damaging Het
Pcdhga2 T C 18: 37,670,789 I562T probably damaging Het
Pcdhgb1 T A 18: 37,680,500 C15S probably benign Het
Pikfyve T G 1: 65,258,843 L1532R probably damaging Het
Rdh7 T A 10: 127,884,739 T255S probably benign Het
Rtel1 A G 2: 181,355,953 T1165A probably benign Het
Sdk2 C T 11: 113,830,048 A1352T probably damaging Het
Strip2 T C 6: 29,941,917 S629P probably damaging Het
Taf5 A G 19: 47,077,337 T494A possibly damaging Het
Tek T G 4: 94,853,434 N809K possibly damaging Het
Tmbim7 A T 5: 3,661,943 T63S probably benign Het
Utrn A T 10: 12,727,764 L624Q probably damaging Het
Xbp1 A G 11: 5,521,809 probably benign Het
Zbp1 T A 2: 173,213,911 probably null Het
Zfp112 T C 7: 24,125,806 C400R probably damaging Het
Zfp202 C T 9: 40,210,235 probably null Het
Zfp747 T C 7: 127,374,047 E317G possibly damaging Het
Other mutations in Olfr155
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02729:Olfr155 APN 4 43854439 missense probably damaging 1.00
R0240:Olfr155 UTSW 4 43854512 missense probably damaging 1.00
R0240:Olfr155 UTSW 4 43854512 missense probably damaging 1.00
R0285:Olfr155 UTSW 4 43854398 missense possibly damaging 0.46
R0427:Olfr155 UTSW 4 43854417 missense probably damaging 1.00
R4468:Olfr155 UTSW 4 43854737 missense probably benign 0.08
R4548:Olfr155 UTSW 4 43854834 missense probably damaging 1.00
R4583:Olfr155 UTSW 4 43855262 missense probably benign
R4793:Olfr155 UTSW 4 43854323 missense probably benign 0.37
R4884:Olfr155 UTSW 4 43854890 missense probably damaging 1.00
R5016:Olfr155 UTSW 4 43854596 missense probably benign 0.02
R5220:Olfr155 UTSW 4 43854624 missense possibly damaging 0.89
R5613:Olfr155 UTSW 4 43854528 missense probably damaging 0.99
R5805:Olfr155 UTSW 4 43855152 missense probably benign 0.15
R5955:Olfr155 UTSW 4 43854898 missense probably damaging 1.00
R6250:Olfr155 UTSW 4 43854363 missense possibly damaging 0.58
R6768:Olfr155 UTSW 4 43854351 missense probably benign 0.01
R6801:Olfr155 UTSW 4 43855206 nonsense probably null
W0251:Olfr155 UTSW 4 43855058 missense probably benign 0.42
Predicted Primers PCR Primer
(F):5'- TCGTTATGTGGCCATCTGC -3'
(R):5'- TCCCGTACATGAAGAGGATGG -3'

Sequencing Primer
(F):5'- TATCCTGTGGTCATGAACAAGGC -3'
(R):5'- TGGTTCCATAGAAGACAAGTACC -3'
Posted On2018-09-12