Incidental Mutation 'R6835:Zfp112'
ID534390
Institutional Source Beutler Lab
Gene Symbol Zfp112
Ensembl Gene ENSMUSG00000052675
Gene Namezinc finger protein 112
Synonyms
MMRRC Submission
Accession Numbers

Genbank: NM_021307; MGI: 1929115

Is this an essential gene? Probably non essential (E-score: 0.212) question?
Stock #R6835 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location24112314-24127952 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 24125806 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 400 (C400R)
Ref Sequence ENSEMBL: ENSMUSP00000150734 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005413] [ENSMUST00000120006] [ENSMUST00000215113]
Predicted Effect probably damaging
Transcript: ENSMUST00000005413
AA Change: C404R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000005413
Gene: ENSMUSG00000052675
AA Change: C404R

DomainStartEndE-ValueType
KRAB 8 68 7.93e-27 SMART
low complexity region 385 397 N/A INTRINSIC
ZnF_C2H2 523 545 4.11e-2 SMART
ZnF_C2H2 551 573 3.44e-4 SMART
ZnF_C2H2 579 601 1.6e-4 SMART
ZnF_C2H2 607 629 1.5e-4 SMART
ZnF_C2H2 635 657 3.89e-3 SMART
ZnF_C2H2 663 685 1.58e-3 SMART
ZnF_C2H2 691 713 6.42e-4 SMART
ZnF_C2H2 719 741 5.99e-4 SMART
ZnF_C2H2 747 769 7.78e-3 SMART
ZnF_C2H2 775 797 3.95e-4 SMART
ZnF_C2H2 803 825 2.01e-5 SMART
ZnF_C2H2 831 853 1.36e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000120006
AA Change: C398R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000113031
Gene: ENSMUSG00000052675
AA Change: C398R

DomainStartEndE-ValueType
KRAB 2 62 7.93e-27 SMART
low complexity region 379 391 N/A INTRINSIC
ZnF_C2H2 517 539 4.11e-2 SMART
ZnF_C2H2 545 567 3.44e-4 SMART
ZnF_C2H2 573 595 1.6e-4 SMART
ZnF_C2H2 601 623 1.5e-4 SMART
ZnF_C2H2 629 651 3.89e-3 SMART
ZnF_C2H2 657 679 1.58e-3 SMART
ZnF_C2H2 685 707 6.42e-4 SMART
ZnF_C2H2 713 735 5.99e-4 SMART
ZnF_C2H2 741 763 7.78e-3 SMART
ZnF_C2H2 769 791 3.95e-4 SMART
ZnF_C2H2 797 819 2.01e-5 SMART
ZnF_C2H2 825 847 1.36e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000215113
AA Change: C400R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 100% (44/44)
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl11 A G 9: 107,930,562 R695G probably benign Het
Arhgef4 A G 1: 34,806,493 H1533R probably damaging Het
Birc6 T C 17: 74,642,504 L3120P probably damaging Het
Cfap46 T A 7: 139,652,498 I850F probably damaging Het
Crym A C 7: 120,186,645 S311A probably benign Het
Cttn T C 7: 144,456,497 probably null Het
Dtnb C T 12: 3,632,841 probably benign Het
Edem1 T C 6: 108,854,399 V607A probably benign Het
Etfa A G 9: 55,495,819 V64A probably benign Het
Fam133b A G 5: 3,554,732 T40A possibly damaging Het
Fmn2 C A 1: 174,699,669 D1442E probably damaging Het
Gpi1 T C 7: 34,227,138 K128E possibly damaging Het
Gpr179 A T 11: 97,347,467 F310L probably damaging Het
Hdac7 T A 15: 97,802,747 H531L probably damaging Het
Hfm1 G A 5: 106,878,815 R145* probably null Het
Hsp90b1 A T 10: 86,694,085 D573E probably damaging Het
Hunk T G 16: 90,472,524 W243G probably damaging Het
Icam1 G T 9: 21,027,125 G327W possibly damaging Het
Ino80d C A 1: 63,074,326 A322S probably benign Het
Itpkc A C 7: 27,227,815 S225A probably benign Het
Krt75 C T 15: 101,571,037 R286Q probably benign Het
Lmnb2 A G 10: 80,909,960 L95P probably damaging Het
Mns1 T C 9: 72,452,744 M392T probably damaging Het
Morc3 A T 16: 93,847,421 N200I probably damaging Het
Mrvi1 T G 7: 110,921,334 E278A probably damaging Het
Myadm T C 7: 3,297,676 V318A possibly damaging Het
Nt5dc1 A C 10: 34,310,379 S398A probably benign Het
Olfr155 T C 4: 43,854,912 V201A probably benign Het
Olfr391-ps A G 11: 73,799,235 I174T possibly damaging Het
Pcdhga2 T C 18: 37,670,789 I562T probably damaging Het
Pcdhgb1 T A 18: 37,680,500 C15S probably benign Het
Pikfyve T G 1: 65,258,843 L1532R probably damaging Het
Rdh7 T A 10: 127,884,739 T255S probably benign Het
Rtel1 A G 2: 181,355,953 T1165A probably benign Het
Sdk2 C T 11: 113,830,048 A1352T probably damaging Het
Strip2 T C 6: 29,941,917 S629P probably damaging Het
Taf5 A G 19: 47,077,337 T494A possibly damaging Het
Tek T G 4: 94,853,434 N809K possibly damaging Het
Tmbim7 A T 5: 3,661,943 T63S probably benign Het
Utrn A T 10: 12,727,764 L624Q probably damaging Het
Xbp1 A G 11: 5,521,809 probably benign Het
Zbp1 T A 2: 173,213,911 probably null Het
Zfp202 C T 9: 40,210,235 probably null Het
Zfp747 T C 7: 127,374,047 E317G possibly damaging Het
Other mutations in Zfp112
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Zfp112 APN 7 24122243 missense probably damaging 1.00
IGL00575:Zfp112 APN 7 24126332 missense probably damaging 1.00
IGL00944:Zfp112 APN 7 24125596 missense probably benign 0.02
IGL01662:Zfp112 APN 7 24125954 missense probably benign 0.44
IGL03383:Zfp112 APN 7 24125678 missense probably damaging 1.00
2107:Zfp112 UTSW 7 24126841 missense probably damaging 1.00
FR4737:Zfp112 UTSW 7 24125407 small insertion probably benign
R0566:Zfp112 UTSW 7 24125677 missense probably benign 0.09
R0581:Zfp112 UTSW 7 24125863 missense probably damaging 0.97
R0613:Zfp112 UTSW 7 24127028 missense probably benign 0.33
R1521:Zfp112 UTSW 7 24125785 missense probably damaging 0.97
R1614:Zfp112 UTSW 7 24126599 missense probably damaging 1.00
R1827:Zfp112 UTSW 7 24124960 missense probably damaging 1.00
R1906:Zfp112 UTSW 7 24122295 missense probably benign 0.34
R1920:Zfp112 UTSW 7 24125237 missense probably benign 0.01
R2008:Zfp112 UTSW 7 24126751 missense probably damaging 1.00
R2012:Zfp112 UTSW 7 24125300 missense possibly damaging 0.69
R2192:Zfp112 UTSW 7 24125438 missense probably damaging 0.98
R2985:Zfp112 UTSW 7 24122295 missense probably benign 0.34
R4191:Zfp112 UTSW 7 24126143 missense probably benign 0.19
R4373:Zfp112 UTSW 7 24125048 missense probably damaging 0.99
R4374:Zfp112 UTSW 7 24126373 missense probably damaging 1.00
R4674:Zfp112 UTSW 7 24126974 missense probably damaging 1.00
R4676:Zfp112 UTSW 7 24126260 missense probably damaging 0.97
R5023:Zfp112 UTSW 7 24126484 missense probably damaging 0.99
R5198:Zfp112 UTSW 7 24124856 missense possibly damaging 0.49
R6559:Zfp112 UTSW 7 24126463 nonsense probably null
R6946:Zfp112 UTSW 7 24125341 missense probably damaging 0.98
R7263:Zfp112 UTSW 7 24125527 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CCCCTCTTAACACTTGTGGG -3'
(R):5'- CCTGTACGGCACAAACGATTG -3'

Sequencing Primer
(F):5'- ACACTTGTGGGTGTGCC -3'
(R):5'- CACTCCTGGAAAGTCCTGAAAATGTG -3'
Posted On2018-09-12