Incidental Mutation 'R6835:Cttn'
ID534397
Institutional Source Beutler Lab
Gene Symbol Cttn
Ensembl Gene ENSMUSG00000031078
Gene Namecortactin
SynonymsEms1, 1110020L01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.257) question?
Stock #R6835 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location144435733-144471009 bp(-) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) T to C at 144456497 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000099368 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033407] [ENSMUST00000103079]
PDB Structure
[]
Lysozyme contamination facilitates crystallization of a hetero-trimericCortactin:Arg:Lysozyme complex [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000033407
SMART Domains Protein: ENSMUSP00000033407
Gene: ENSMUSG00000031078

DomainStartEndE-ValueType
Pfam:HS1_rep 83 119 1.3e-22 PFAM
Pfam:HS1_rep 120 156 8.6e-25 PFAM
Pfam:HS1_rep 157 193 3.4e-25 PFAM
Pfam:HS1_rep 194 230 1.9e-23 PFAM
Pfam:HS1_rep 231 267 1.2e-24 PFAM
Pfam:HS1_rep 268 293 2.4e-10 PFAM
coiled coil region 311 364 N/A INTRINSIC
SH3 454 509 6.84e-24 SMART
Predicted Effect probably null
Transcript: ENSMUST00000103079
SMART Domains Protein: ENSMUSP00000099368
Gene: ENSMUSG00000031078

DomainStartEndE-ValueType
Pfam:HS1_rep 83 118 2.7e-22 PFAM
Pfam:HS1_rep 120 155 2.9e-23 PFAM
Pfam:HS1_rep 157 192 8.2e-24 PFAM
Pfam:HS1_rep 194 229 7.5e-22 PFAM
Pfam:HS1_rep 231 266 6.6e-25 PFAM
Pfam:HS1_rep 268 303 2.3e-22 PFAM
Pfam:HS1_rep 305 332 4.3e-13 PFAM
coiled coil region 348 401 N/A INTRINSIC
SH3 491 546 6.84e-24 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is overexpressed in breast cancer and squamous cell carcinomas of the head and neck. The encoded protein is localized in the cytoplasm and in areas of the cell-substratum contacts. This gene has two roles: (1) regulating the interactions between components of adherens-type junctions and (2) organizing the cytoskeleton and cell adhesion structures of epithelia and carcinoma cells. During apoptosis, the encoded protein is degraded in a caspase-dependent manner. The aberrant regulation of this gene contributes to tumor cell invasion and metastasis. Three splice variants that encode different isoforms have been identified for this gene. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for one knock-out allele exhibit abnormal early zygote development and die prior to the 2-cell stage. Mice homozygous for a different knock-out allele exhibit increased permeability in vascular and lung endothelial cells and impaired neutrophil extravasation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl11 A G 9: 107,930,562 R695G probably benign Het
Arhgef4 A G 1: 34,806,493 H1533R probably damaging Het
Birc6 T C 17: 74,642,504 L3120P probably damaging Het
Cfap46 T A 7: 139,652,498 I850F probably damaging Het
Crym A C 7: 120,186,645 S311A probably benign Het
Dtnb C T 12: 3,632,841 probably benign Het
Edem1 T C 6: 108,854,399 V607A probably benign Het
Etfa A G 9: 55,495,819 V64A probably benign Het
Fam133b A G 5: 3,554,732 T40A possibly damaging Het
Fmn2 C A 1: 174,699,669 D1442E probably damaging Het
Gpi1 T C 7: 34,227,138 K128E possibly damaging Het
Gpr179 A T 11: 97,347,467 F310L probably damaging Het
Hdac7 T A 15: 97,802,747 H531L probably damaging Het
Hfm1 G A 5: 106,878,815 R145* probably null Het
Hsp90b1 A T 10: 86,694,085 D573E probably damaging Het
Hunk T G 16: 90,472,524 W243G probably damaging Het
Icam1 G T 9: 21,027,125 G327W possibly damaging Het
Ino80d C A 1: 63,074,326 A322S probably benign Het
Itpkc A C 7: 27,227,815 S225A probably benign Het
Krt75 C T 15: 101,571,037 R286Q probably benign Het
Lmnb2 A G 10: 80,909,960 L95P probably damaging Het
Mns1 T C 9: 72,452,744 M392T probably damaging Het
Morc3 A T 16: 93,847,421 N200I probably damaging Het
Mrvi1 T G 7: 110,921,334 E278A probably damaging Het
Myadm T C 7: 3,297,676 V318A possibly damaging Het
Nt5dc1 A C 10: 34,310,379 S398A probably benign Het
Olfr155 T C 4: 43,854,912 V201A probably benign Het
Olfr391-ps A G 11: 73,799,235 I174T possibly damaging Het
Pcdhga2 T C 18: 37,670,789 I562T probably damaging Het
Pcdhgb1 T A 18: 37,680,500 C15S probably benign Het
Pikfyve T G 1: 65,258,843 L1532R probably damaging Het
Rdh7 T A 10: 127,884,739 T255S probably benign Het
Rtel1 A G 2: 181,355,953 T1165A probably benign Het
Sdk2 C T 11: 113,830,048 A1352T probably damaging Het
Strip2 T C 6: 29,941,917 S629P probably damaging Het
Taf5 A G 19: 47,077,337 T494A possibly damaging Het
Tek T G 4: 94,853,434 N809K possibly damaging Het
Tmbim7 A T 5: 3,661,943 T63S probably benign Het
Utrn A T 10: 12,727,764 L624Q probably damaging Het
Xbp1 A G 11: 5,521,809 probably benign Het
Zbp1 T A 2: 173,213,911 probably null Het
Zfp112 T C 7: 24,125,806 C400R probably damaging Het
Zfp202 C T 9: 40,210,235 probably null Het
Zfp747 T C 7: 127,374,047 E317G possibly damaging Het
Other mutations in Cttn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01395:Cttn APN 7 144457727 missense probably damaging 0.99
IGL01432:Cttn APN 7 144461306 missense probably damaging 0.98
IGL02652:Cttn APN 7 144441731 missense probably benign 0.00
PIT4377001:Cttn UTSW 7 144440096 missense possibly damaging 0.71
R0226:Cttn UTSW 7 144441852 splice site probably benign
R0346:Cttn UTSW 7 144452539 splice site probably benign
R1220:Cttn UTSW 7 144463962 missense probably benign
R3807:Cttn UTSW 7 144445851 missense probably damaging 1.00
R4080:Cttn UTSW 7 144457724 missense probably damaging 1.00
R4578:Cttn UTSW 7 144454716 missense probably damaging 1.00
R5806:Cttn UTSW 7 144461268 missense probably damaging 0.99
R6985:Cttn UTSW 7 144452587 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAGAGAAGGCAGCTTCCTCTG -3'
(R):5'- TCCGTTCAGTGAGACCATCTC -3'

Sequencing Primer
(F):5'- AAGGCAGCTTCCTCTGGAGTC -3'
(R):5'- TCTCAAAGGCCTAAAGAAACAGTG -3'
Posted On2018-09-12