Incidental Mutation 'R6835:Actl11'
ID534401
Institutional Source Beutler Lab
Gene Symbol Actl11
Ensembl Gene ENSMUSG00000066368
Gene Nameactin-like 11
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R6835 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location107928469-107932461 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 107930562 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 695 (R695G)
Ref Sequence ENSEMBL: ENSMUSP00000082150 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085073]
Predicted Effect probably benign
Transcript: ENSMUST00000085073
AA Change: R695G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000082150
Gene: ENSMUSG00000066368
AA Change: R695G

DomainStartEndE-ValueType
low complexity region 223 239 N/A INTRINSIC
low complexity region 301 309 N/A INTRINSIC
low complexity region 374 391 N/A INTRINSIC
low complexity region 492 507 N/A INTRINSIC
low complexity region 697 710 N/A INTRINSIC
ACTIN 858 1207 4.26e-81 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 100% (44/44)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef4 A G 1: 34,806,493 H1533R probably damaging Het
Birc6 T C 17: 74,642,504 L3120P probably damaging Het
Cfap46 T A 7: 139,652,498 I850F probably damaging Het
Crym A C 7: 120,186,645 S311A probably benign Het
Cttn T C 7: 144,456,497 probably null Het
Dtnb C T 12: 3,632,841 probably benign Het
Edem1 T C 6: 108,854,399 V607A probably benign Het
Etfa A G 9: 55,495,819 V64A probably benign Het
Fam133b A G 5: 3,554,732 T40A possibly damaging Het
Fmn2 C A 1: 174,699,669 D1442E probably damaging Het
Gpi1 T C 7: 34,227,138 K128E possibly damaging Het
Gpr179 A T 11: 97,347,467 F310L probably damaging Het
Hdac7 T A 15: 97,802,747 H531L probably damaging Het
Hfm1 G A 5: 106,878,815 R145* probably null Het
Hsp90b1 A T 10: 86,694,085 D573E probably damaging Het
Hunk T G 16: 90,472,524 W243G probably damaging Het
Icam1 G T 9: 21,027,125 G327W possibly damaging Het
Ino80d C A 1: 63,074,326 A322S probably benign Het
Itpkc A C 7: 27,227,815 S225A probably benign Het
Krt75 C T 15: 101,571,037 R286Q probably benign Het
Lmnb2 A G 10: 80,909,960 L95P probably damaging Het
Mns1 T C 9: 72,452,744 M392T probably damaging Het
Morc3 A T 16: 93,847,421 N200I probably damaging Het
Mrvi1 T G 7: 110,921,334 E278A probably damaging Het
Myadm T C 7: 3,297,676 V318A possibly damaging Het
Nt5dc1 A C 10: 34,310,379 S398A probably benign Het
Olfr155 T C 4: 43,854,912 V201A probably benign Het
Olfr391-ps A G 11: 73,799,235 I174T possibly damaging Het
Pcdhga2 T C 18: 37,670,789 I562T probably damaging Het
Pcdhgb1 T A 18: 37,680,500 C15S probably benign Het
Pikfyve T G 1: 65,258,843 L1532R probably damaging Het
Rdh7 T A 10: 127,884,739 T255S probably benign Het
Rtel1 A G 2: 181,355,953 T1165A probably benign Het
Sdk2 C T 11: 113,830,048 A1352T probably damaging Het
Strip2 T C 6: 29,941,917 S629P probably damaging Het
Taf5 A G 19: 47,077,337 T494A possibly damaging Het
Tek T G 4: 94,853,434 N809K possibly damaging Het
Tmbim7 A T 5: 3,661,943 T63S probably benign Het
Utrn A T 10: 12,727,764 L624Q probably damaging Het
Xbp1 A G 11: 5,521,809 probably benign Het
Zbp1 T A 2: 173,213,911 probably null Het
Zfp112 T C 7: 24,125,806 C400R probably damaging Het
Zfp202 C T 9: 40,210,235 probably null Het
Zfp747 T C 7: 127,374,047 E317G possibly damaging Het
Other mutations in Actl11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01081:Actl11 APN 9 107928982 missense possibly damaging 0.49
IGL01396:Actl11 APN 9 107928765 missense possibly damaging 0.71
IGL01622:Actl11 APN 9 107928576 missense probably benign 0.03
IGL01623:Actl11 APN 9 107928576 missense probably benign 0.03
IGL01660:Actl11 APN 9 107929048 missense probably benign
IGL01912:Actl11 APN 9 107929645 missense probably damaging 0.98
IGL02002:Actl11 APN 9 107929330 missense probably benign 0.08
IGL02266:Actl11 APN 9 107931183 missense possibly damaging 0.76
IGL02535:Actl11 APN 9 107929937 missense possibly damaging 0.71
IGL02692:Actl11 APN 9 107929308 missense probably benign 0.06
IGL02744:Actl11 APN 9 107929862 missense probably benign 0.04
IGL02864:Actl11 APN 9 107928987 missense probably benign 0.25
IGL03037:Actl11 APN 9 107930095 missense probably damaging 0.99
IGL03085:Actl11 APN 9 107929550 missense probably damaging 0.98
R0167:Actl11 UTSW 9 107929770 missense probably damaging 1.00
R0304:Actl11 UTSW 9 107929768 missense probably damaging 1.00
R0959:Actl11 UTSW 9 107931235 missense probably damaging 1.00
R1499:Actl11 UTSW 9 107931483 missense probably damaging 1.00
R1616:Actl11 UTSW 9 107931936 missense probably benign 0.39
R1694:Actl11 UTSW 9 107930008 missense probably damaging 1.00
R1927:Actl11 UTSW 9 107929537 missense possibly damaging 0.88
R2081:Actl11 UTSW 9 107930197 missense probably benign
R2939:Actl11 UTSW 9 107931210 missense possibly damaging 0.84
R3427:Actl11 UTSW 9 107929770 missense probably damaging 1.00
R4812:Actl11 UTSW 9 107931130 missense probably damaging 0.99
R4843:Actl11 UTSW 9 107929492 missense possibly damaging 0.61
R4972:Actl11 UTSW 9 107929956 missense probably benign 0.07
R4989:Actl11 UTSW 9 107931416 missense probably damaging 1.00
R4996:Actl11 UTSW 9 107931735 missense possibly damaging 0.77
R5320:Actl11 UTSW 9 107931004 missense possibly damaging 0.73
R5546:Actl11 UTSW 9 107929633 missense probably benign 0.00
R5810:Actl11 UTSW 9 107929221 missense probably benign 0.23
R6302:Actl11 UTSW 9 107929573 missense probably benign 0.12
R6412:Actl11 UTSW 9 107929917 missense probably benign 0.01
R6891:Actl11 UTSW 9 107929147 missense probably benign 0.03
R7195:Actl11 UTSW 9 107928870 nonsense probably null
R7212:Actl11 UTSW 9 107928657 missense probably damaging 0.99
X0024:Actl11 UTSW 9 107930505 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGGACAAGTCTTCCTCACTGG -3'
(R):5'- CCAGGACTGGGGCTGATTTATG -3'

Sequencing Primer
(F):5'- CACTGGACAGAGTTTCCTCAATGG -3'
(R):5'- GATTTATGCTGGACCTTTGAACC -3'
Posted On2018-09-12