Incidental Mutation 'R6835:Hsp90b1'
ID534405
Institutional Source Beutler Lab
Gene Symbol Hsp90b1
Ensembl Gene ENSMUSG00000020048
Gene Nameheat shock protein 90, beta (Grp94), member 1
SynonymsERp99, tumor rejection antigen (gp96) 1, Targ2, endoplasmin, Tra-1, Tra1, gp96, GRP94, 90 kDa
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6835 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location86690209-86705509 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 86694085 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 573 (D573E)
Ref Sequence ENSEMBL: ENSMUSP00000020238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020238] [ENSMUST00000129413]
Predicted Effect probably damaging
Transcript: ENSMUST00000020238
AA Change: D573E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000020238
Gene: ENSMUSG00000020048
AA Change: D573E

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 22 34 N/A INTRINSIC
HATPase_c 96 255 4.96e-9 SMART
Pfam:HSP90 257 781 2.5e-233 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000129413
AA Change: D249E

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000122710
Gene: ENSMUSG00000020048
AA Change: D249E

DomainStartEndE-ValueType
coiled coil region 9 35 N/A INTRINSIC
Pfam:HSP90 39 373 3.8e-170 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of adenosine triphosphate(ATP)-metabolizing molecular chaperones with roles in stabilizing and folding other proteins. The encoded protein is localized to melanosomes and the endoplasmic reticulum. Expression of this protein is associated with a variety of pathogenic states, including tumor formation. There is a microRNA gene located within the 5' exon of this gene. There are pseudogenes for this gene on chromosomes 1 and 15. [provided by RefSeq, Aug 2012]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality before somite formation with failure of primitive streak formation, absence of the chorion and amnion, and failure of mesoderm formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl11 A G 9: 107,930,562 R695G probably benign Het
Arhgef4 A G 1: 34,806,493 H1533R probably damaging Het
Birc6 T C 17: 74,642,504 L3120P probably damaging Het
Cfap46 T A 7: 139,652,498 I850F probably damaging Het
Crym A C 7: 120,186,645 S311A probably benign Het
Cttn T C 7: 144,456,497 probably null Het
Dtnb C T 12: 3,632,841 probably benign Het
Edem1 T C 6: 108,854,399 V607A probably benign Het
Etfa A G 9: 55,495,819 V64A probably benign Het
Fam133b A G 5: 3,554,732 T40A possibly damaging Het
Fmn2 C A 1: 174,699,669 D1442E probably damaging Het
Gpi1 T C 7: 34,227,138 K128E possibly damaging Het
Gpr179 A T 11: 97,347,467 F310L probably damaging Het
Hdac7 T A 15: 97,802,747 H531L probably damaging Het
Hfm1 G A 5: 106,878,815 R145* probably null Het
Hunk T G 16: 90,472,524 W243G probably damaging Het
Icam1 G T 9: 21,027,125 G327W possibly damaging Het
Ino80d C A 1: 63,074,326 A322S probably benign Het
Itpkc A C 7: 27,227,815 S225A probably benign Het
Krt75 C T 15: 101,571,037 R286Q probably benign Het
Lmnb2 A G 10: 80,909,960 L95P probably damaging Het
Mns1 T C 9: 72,452,744 M392T probably damaging Het
Morc3 A T 16: 93,847,421 N200I probably damaging Het
Mrvi1 T G 7: 110,921,334 E278A probably damaging Het
Myadm T C 7: 3,297,676 V318A possibly damaging Het
Nt5dc1 A C 10: 34,310,379 S398A probably benign Het
Olfr155 T C 4: 43,854,912 V201A probably benign Het
Olfr391-ps A G 11: 73,799,235 I174T possibly damaging Het
Pcdhga2 T C 18: 37,670,789 I562T probably damaging Het
Pcdhgb1 T A 18: 37,680,500 C15S probably benign Het
Pikfyve T G 1: 65,258,843 L1532R probably damaging Het
Rdh7 T A 10: 127,884,739 T255S probably benign Het
Rtel1 A G 2: 181,355,953 T1165A probably benign Het
Sdk2 C T 11: 113,830,048 A1352T probably damaging Het
Strip2 T C 6: 29,941,917 S629P probably damaging Het
Taf5 A G 19: 47,077,337 T494A possibly damaging Het
Tek T G 4: 94,853,434 N809K possibly damaging Het
Tmbim7 A T 5: 3,661,943 T63S probably benign Het
Utrn A T 10: 12,727,764 L624Q probably damaging Het
Xbp1 A G 11: 5,521,809 probably benign Het
Zbp1 T A 2: 173,213,911 probably null Het
Zfp112 T C 7: 24,125,806 C400R probably damaging Het
Zfp202 C T 9: 40,210,235 probably null Het
Zfp747 T C 7: 127,374,047 E317G possibly damaging Het
Other mutations in Hsp90b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01550:Hsp90b1 APN 10 86704370 missense probably benign 0.40
IGL01671:Hsp90b1 APN 10 86704325 missense probably benign 0.07
IGL01673:Hsp90b1 APN 10 86693432 missense probably damaging 0.99
IGL02097:Hsp90b1 APN 10 86691684 unclassified probably benign
IGL02124:Hsp90b1 APN 10 86705358 unclassified probably benign
IGL02257:Hsp90b1 APN 10 86698589 missense probably damaging 1.00
IGL02339:Hsp90b1 APN 10 86701814 missense probably damaging 1.00
IGL02342:Hsp90b1 APN 10 86695739 critical splice acceptor site probably null
R0329:Hsp90b1 UTSW 10 86694155 missense probably damaging 1.00
R0330:Hsp90b1 UTSW 10 86694155 missense probably damaging 1.00
R0735:Hsp90b1 UTSW 10 86695748 splice site probably benign
R1531:Hsp90b1 UTSW 10 86696795 missense probably benign 0.02
R1540:Hsp90b1 UTSW 10 86694042 missense probably damaging 1.00
R1711:Hsp90b1 UTSW 10 86694525 missense probably damaging 1.00
R1797:Hsp90b1 UTSW 10 86701745 missense possibly damaging 0.86
R2128:Hsp90b1 UTSW 10 86695706 missense probably damaging 1.00
R2129:Hsp90b1 UTSW 10 86695706 missense probably damaging 1.00
R2903:Hsp90b1 UTSW 10 86703485 missense probably damaging 1.00
R4735:Hsp90b1 UTSW 10 86693955 missense probably damaging 1.00
R4749:Hsp90b1 UTSW 10 86701808 missense probably damaging 1.00
R5011:Hsp90b1 UTSW 10 86696753 missense probably benign 0.37
R5650:Hsp90b1 UTSW 10 86693503 missense probably damaging 1.00
R5950:Hsp90b1 UTSW 10 86701745 missense possibly damaging 0.86
R6731:Hsp90b1 UTSW 10 86701905 missense probably benign 0.01
R7038:Hsp90b1 UTSW 10 86695866 missense probably damaging 0.99
R7250:Hsp90b1 UTSW 10 86691708 missense unknown
R7343:Hsp90b1 UTSW 10 86692183 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAATACCTTGTCCTTGAGGGCC -3'
(R):5'- GCATACAGCCAATGTGGGAG -3'

Sequencing Primer
(F):5'- CTTATCTTTCATCCAGTTGAGCAGAG -3'
(R):5'- CTGGGATAGTTAGGCAGACACC -3'
Posted On2018-09-12