Incidental Mutation 'R6833:Glb1l'
ID534422
Institutional Source Beutler Lab
Gene Symbol Glb1l
Ensembl Gene ENSMUSG00000026200
Gene Namegalactosidase, beta 1-like
Synonyms4833408P15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.147) question?
Stock #R6833 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location75198236-75210813 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 75201753 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 347 (V347A)
Ref Sequence ENSEMBL: ENSMUSP00000136285 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113623] [ENSMUST00000145459] [ENSMUST00000152233] [ENSMUST00000155716] [ENSMUST00000185448]
Predicted Effect possibly damaging
Transcript: ENSMUST00000113623
AA Change: V347A

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000109253
Gene: ENSMUSG00000026200
AA Change: V347A

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
Pfam:Glyco_hydro_35 34 351 4.1e-123 PFAM
Pfam:Glyco_hydro_42 48 209 6.6e-12 PFAM
low complexity region 355 371 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145459
SMART Domains Protein: ENSMUSP00000135971
Gene: ENSMUSG00000026199

DomainStartEndE-ValueType
low complexity region 19 45 N/A INTRINSIC
Blast:ZnF_C2H2 96 120 1e-9 BLAST
low complexity region 143 171 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152233
SMART Domains Protein: ENSMUSP00000136163
Gene: ENSMUSG00000026199

DomainStartEndE-ValueType
low complexity region 19 45 N/A INTRINSIC
Blast:ZnF_C2H2 96 120 6e-11 BLAST
low complexity region 143 171 N/A INTRINSIC
low complexity region 394 407 N/A INTRINSIC
low complexity region 425 451 N/A INTRINSIC
low complexity region 459 469 N/A INTRINSIC
Blast:ANK 515 545 2e-9 BLAST
ANK 556 585 6.81e-3 SMART
coiled coil region 628 681 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000155716
AA Change: V347A

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000136285
Gene: ENSMUSG00000026200
AA Change: V347A

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
Pfam:Glyco_hydro_35 34 351 4.2e-125 PFAM
Pfam:Glyco_hydro_42 48 209 6.6e-12 PFAM
low complexity region 355 371 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000185448
SMART Domains Protein: ENSMUSP00000140820
Gene: ENSMUSG00000026200

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Glyco_hydro_35 34 188 1.6e-71 PFAM
Pfam:Glyco_hydro_42 48 188 6.4e-10 PFAM
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000189663
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 96% (54/56)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik T A 1: 11,588,509 W215R probably damaging Het
Aco1 A G 4: 40,164,747 K79R probably benign Het
Adam28 C T 14: 68,618,127 A630T probably benign Het
Alpk2 T C 18: 65,306,409 K1105E probably benign Het
Angptl1 A T 1: 156,844,693 I30L probably benign Het
Astn1 A T 1: 158,664,122 Q47L probably benign Het
Atf6b T C 17: 34,649,157 S135P probably damaging Het
Ccdc122 G T 14: 77,088,931 probably benign Het
Cers3 T C 7: 66,779,671 probably null Het
Dcaf10 T C 4: 45,373,043 C95R probably damaging Het
Dcxr A G 11: 120,726,091 Y149H probably damaging Het
Dmxl1 A T 18: 49,955,823 I2790F probably damaging Het
Dnhd1 T A 7: 105,703,373 C2578S probably benign Het
Dnttip2 T C 3: 122,276,803 S556P probably damaging Het
Efr3a T G 15: 65,842,686 V301G probably damaging Het
Eml5 A T 12: 98,887,024 H105Q probably damaging Het
Enpp3 T A 10: 24,809,870 H44L probably damaging Het
Fam120a A G 13: 48,934,041 V281A probably damaging Het
Fat3 C T 9: 15,915,061 E4532K possibly damaging Het
Ferd3l G A 12: 33,928,538 V17I probably damaging Het
Gm4846 A T 1: 166,494,578 I140N possibly damaging Het
Gm9195 T C 14: 72,434,416 T2586A possibly damaging Het
H2-Ke6 T C 17: 34,027,217 S161G probably damaging Het
Hsp90ab1 T C 17: 45,570,467 I250V probably benign Het
Il11ra1 A G 4: 41,765,454 H183R probably benign Het
Kdelc2 A G 9: 53,392,008 I67V possibly damaging Het
Lama3 G A 18: 12,491,548 C1450Y probably damaging Het
Lgals7 G A 7: 28,865,662 R75Q probably damaging Het
Lpcat3 A G 6: 124,700,011 Y124C probably damaging Het
Lrrc8a T A 2: 30,255,647 S158T possibly damaging Het
Mcm3 A T 1: 20,810,096 M504K possibly damaging Het
Mro G T 18: 73,863,932 probably benign Het
Mybpc3 A G 2: 91,125,428 probably null Het
Myh14 T A 7: 44,624,379 K1356* probably null Het
Myo5b A C 18: 74,770,325 Q1804P probably benign Het
Nol10 A G 12: 17,352,727 I67V probably benign Het
Pam T A 1: 97,837,992 I771F probably damaging Het
Pcdhgb8 G T 18: 37,762,089 A71S probably benign Het
Pmfbp1 T C 8: 109,538,675 probably null Het
Poc1b C T 10: 99,192,804 A336V probably benign Het
Prap1 C A 7: 140,095,082 A20E possibly damaging Het
Prox1 G A 1: 190,160,778 A490V probably damaging Het
Prss39 G T 1: 34,498,616 V54F possibly damaging Het
Sema3b T A 9: 107,603,316 E144V probably benign Het
Sft2d1 C T 17: 8,318,875 T32I possibly damaging Het
Smpd2 C T 10: 41,488,446 A160T probably damaging Het
Stard9 G T 2: 120,701,259 V2666F probably damaging Het
Syt7 T A 19: 10,444,144 M400K probably damaging Het
Thoc5 T C 11: 4,919,804 L402P probably damaging Het
Tinf2 A T 14: 55,681,580 M1K probably null Het
Ttc21a A G 9: 119,942,635 I167V probably benign Het
Vldlr T C 19: 27,240,574 L474P probably damaging Het
Xirp2 T C 2: 67,509,950 V845A probably benign Het
Zdhhc7 A T 8: 120,084,924 M180K probably damaging Het
Zfp735 G A 11: 73,710,608 G126D probably damaging Het
Other mutations in Glb1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01062:Glb1l APN 1 75201238 missense probably damaging 0.99
IGL01477:Glb1l APN 1 75208706 missense probably damaging 1.00
R0408:Glb1l UTSW 1 75208835 missense probably damaging 1.00
R0620:Glb1l UTSW 1 75199720 missense probably damaging 1.00
R1639:Glb1l UTSW 1 75199601 missense probably benign 0.16
R1842:Glb1l UTSW 1 75200460 missense probably damaging 0.96
R2508:Glb1l UTSW 1 75201829 missense probably damaging 0.99
R2920:Glb1l UTSW 1 75209190 missense probably benign
R3439:Glb1l UTSW 1 75202620 missense probably damaging 1.00
R4096:Glb1l UTSW 1 75209440 start codon destroyed probably benign 0.01
R4517:Glb1l UTSW 1 75208703 missense probably damaging 1.00
R4829:Glb1l UTSW 1 75200350 missense probably damaging 0.96
R4851:Glb1l UTSW 1 75208884 unclassified probably benign
R4859:Glb1l UTSW 1 75200319 splice site probably benign
R4951:Glb1l UTSW 1 75208375 missense probably damaging 1.00
R6163:Glb1l UTSW 1 75201407 missense probably benign
R6519:Glb1l UTSW 1 75201056 missense probably benign 0.41
R6693:Glb1l UTSW 1 75209101 missense probably damaging 1.00
R6713:Glb1l UTSW 1 75202417 missense probably benign 0.02
R6834:Glb1l UTSW 1 75201753 missense possibly damaging 0.93
R7068:Glb1l UTSW 1 75202737 missense probably damaging 1.00
R7453:Glb1l UTSW 1 75202706 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCATGAAGACCCATAATTCTTC -3'
(R):5'- GTGTATGATGACCACTTCCCC -3'

Sequencing Primer
(F):5'- TCACATGTGGAATTCCCCAG -3'
(R):5'- GACAAGATTTTCTGCACAAGGCTCTG -3'
Posted On2018-09-12