Incidental Mutation 'R6833:Gm4846'
ID534426
Institutional Source Beutler Lab
Gene Symbol Gm4846
Ensembl Gene ENSMUSG00000086056
Gene Namepredicted gene 4846
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R6833 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location166483613-166497588 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 166494578 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 140 (I140N)
Ref Sequence ENSEMBL: ENSMUSP00000123476 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000143922]
Predicted Effect possibly damaging
Transcript: ENSMUST00000143922
AA Change: I140N

PolyPhen 2 Score 0.630 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000123476
Gene: ENSMUSG00000086056
AA Change: I140N

DomainStartEndE-ValueType
Pfam:FMO-like 3 534 9.2e-239 PFAM
Pfam:Pyr_redox_2 4 227 1.1e-10 PFAM
Pfam:Pyr_redox_3 7 221 1.9e-12 PFAM
Pfam:NAD_binding_8 8 92 4.2e-7 PFAM
Pfam:K_oxygenase 77 333 3.4e-9 PFAM
Meta Mutation Damage Score 0.0544 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 96% (54/56)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik T A 1: 11,588,509 W215R probably damaging Het
Aco1 A G 4: 40,164,747 K79R probably benign Het
Adam28 C T 14: 68,618,127 A630T probably benign Het
Alpk2 T C 18: 65,306,409 K1105E probably benign Het
Angptl1 A T 1: 156,844,693 I30L probably benign Het
Astn1 A T 1: 158,664,122 Q47L probably benign Het
Atf6b T C 17: 34,649,157 S135P probably damaging Het
Ccdc122 G T 14: 77,088,931 probably benign Het
Cers3 T C 7: 66,779,671 probably null Het
Dcaf10 T C 4: 45,373,043 C95R probably damaging Het
Dcxr A G 11: 120,726,091 Y149H probably damaging Het
Dmxl1 A T 18: 49,955,823 I2790F probably damaging Het
Dnhd1 T A 7: 105,703,373 C2578S probably benign Het
Dnttip2 T C 3: 122,276,803 S556P probably damaging Het
Efr3a T G 15: 65,842,686 V301G probably damaging Het
Eml5 A T 12: 98,887,024 H105Q probably damaging Het
Enpp3 T A 10: 24,809,870 H44L probably damaging Het
Fam120a A G 13: 48,934,041 V281A probably damaging Het
Fat3 C T 9: 15,915,061 E4532K possibly damaging Het
Ferd3l G A 12: 33,928,538 V17I probably damaging Het
Glb1l A G 1: 75,201,753 V347A possibly damaging Het
Gm9195 T C 14: 72,434,416 T2586A possibly damaging Het
H2-Ke6 T C 17: 34,027,217 S161G probably damaging Het
Hsp90ab1 T C 17: 45,570,467 I250V probably benign Het
Il11ra1 A G 4: 41,765,454 H183R probably benign Het
Kdelc2 A G 9: 53,392,008 I67V possibly damaging Het
Lama3 G A 18: 12,491,548 C1450Y probably damaging Het
Lgals7 G A 7: 28,865,662 R75Q probably damaging Het
Lpcat3 A G 6: 124,700,011 Y124C probably damaging Het
Lrrc8a T A 2: 30,255,647 S158T possibly damaging Het
Mcm3 A T 1: 20,810,096 M504K possibly damaging Het
Mro G T 18: 73,863,932 probably benign Het
Mybpc3 A G 2: 91,125,428 probably null Het
Myh14 T A 7: 44,624,379 K1356* probably null Het
Myo5b A C 18: 74,770,325 Q1804P probably benign Het
Nol10 A G 12: 17,352,727 I67V probably benign Het
Pam T A 1: 97,837,992 I771F probably damaging Het
Pcdhgb8 G T 18: 37,762,089 A71S probably benign Het
Pmfbp1 T C 8: 109,538,675 probably null Het
Poc1b C T 10: 99,192,804 A336V probably benign Het
Prap1 C A 7: 140,095,082 A20E possibly damaging Het
Prox1 G A 1: 190,160,778 A490V probably damaging Het
Prss39 G T 1: 34,498,616 V54F possibly damaging Het
Sema3b T A 9: 107,603,316 E144V probably benign Het
Sft2d1 C T 17: 8,318,875 T32I possibly damaging Het
Smpd2 C T 10: 41,488,446 A160T probably damaging Het
Stard9 G T 2: 120,701,259 V2666F probably damaging Het
Syt7 T A 19: 10,444,144 M400K probably damaging Het
Thoc5 T C 11: 4,919,804 L402P probably damaging Het
Tinf2 A T 14: 55,681,580 M1K probably null Het
Ttc21a A G 9: 119,942,635 I167V probably benign Het
Vldlr T C 19: 27,240,574 L474P probably damaging Het
Xirp2 T C 2: 67,509,950 V845A probably benign Het
Zdhhc7 A T 8: 120,084,924 M180K probably damaging Het
Zfp735 G A 11: 73,710,608 G126D probably damaging Het
Other mutations in Gm4846
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02682:Gm4846 APN 1 166494626 missense probably damaging 1.00
IGL02975:Gm4846 APN 1 166483880 missense possibly damaging 0.46
R0504:Gm4846 UTSW 1 166491545 missense probably benign 0.04
R0989:Gm4846 UTSW 1 166487120 missense possibly damaging 0.81
R1836:Gm4846 UTSW 1 166483923 missense probably benign 0.17
R1965:Gm4846 UTSW 1 166486964 missense possibly damaging 0.93
R3120:Gm4846 UTSW 1 166491548 missense probably benign 0.11
R4013:Gm4846 UTSW 1 166494680 splice site probably null
R4617:Gm4846 UTSW 1 166495981 missense probably damaging 1.00
R4641:Gm4846 UTSW 1 166483893 missense probably damaging 0.99
R4825:Gm4846 UTSW 1 166491668 missense probably damaging 1.00
R4952:Gm4846 UTSW 1 166483934 missense probably damaging 0.97
R5135:Gm4846 UTSW 1 166483982 missense probably damaging 1.00
R5230:Gm4846 UTSW 1 166490179 missense probably benign 0.26
R5335:Gm4846 UTSW 1 166497453 nonsense probably null
R5711:Gm4846 UTSW 1 166484025 missense probably benign 0.12
R5957:Gm4846 UTSW 1 166486953 missense probably benign
R6024:Gm4846 UTSW 1 166490127 missense probably benign 0.00
R6460:Gm4846 UTSW 1 166497513 missense probably benign 0.00
R6764:Gm4846 UTSW 1 166491552 missense probably benign
R6834:Gm4846 UTSW 1 166494578 missense possibly damaging 0.63
R7161:Gm4846 UTSW 1 166487010 missense probably damaging 1.00
R7275:Gm4846 UTSW 1 166487079 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCCTGACTGTTAAGGAAGCAG -3'
(R):5'- CTAAAGAATCAGGATCTCGGGGTG -3'

Sequencing Primer
(F):5'- TTTTTCCGTAACCATTCTATGCC -3'
(R):5'- GAAGCGCCCTGATTTTTC -3'
Posted On2018-09-12