Incidental Mutation 'R6833:Lrrc8a'
ID534428
Institutional Source Beutler Lab
Gene Symbol Lrrc8a
Ensembl Gene ENSMUSG00000007476
Gene Nameleucine rich repeat containing 8A
SynonymsLrrc8
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6833 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location30237715-30263790 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 30255647 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 158 (S158T)
Ref Sequence ENSEMBL: ENSMUSP00000139038 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095078] [ENSMUST00000113654] [ENSMUST00000139454]
Predicted Effect possibly damaging
Transcript: ENSMUST00000095078
AA Change: S158T

PolyPhen 2 Score 0.920 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000092690
Gene: ENSMUSG00000007476
AA Change: S158T

DomainStartEndE-ValueType
Pfam:Pannexin_like 1 340 1.4e-146 PFAM
low complexity region 445 455 N/A INTRINSIC
internal_repeat_1 461 526 7.6e-5 PROSPERO
low complexity region 540 558 N/A INTRINSIC
LRR 590 613 5.41e0 SMART
LRR 614 636 3.18e2 SMART
LRR 638 660 6.78e1 SMART
LRR_TYP 661 684 1.06e-4 SMART
LRR 685 706 1.15e1 SMART
LRR_TYP 707 730 1.92e-2 SMART
LRR 731 751 1.81e2 SMART
LRR 753 776 2.02e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000113654
AA Change: S158T

PolyPhen 2 Score 0.920 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000109284
Gene: ENSMUSG00000007476
AA Change: S158T

DomainStartEndE-ValueType
Pfam:DUF3733 1 65 3.3e-32 PFAM
Pfam:DUF3733 97 156 2e-22 PFAM
transmembrane domain 320 342 N/A INTRINSIC
low complexity region 445 455 N/A INTRINSIC
internal_repeat_1 461 526 7.6e-5 PROSPERO
low complexity region 540 558 N/A INTRINSIC
LRR 590 613 5.41e0 SMART
LRR 614 636 3.18e2 SMART
LRR 638 660 6.78e1 SMART
LRR_TYP 661 684 1.06e-4 SMART
LRR 685 706 1.15e1 SMART
LRR_TYP 707 730 1.92e-2 SMART
LRR 731 751 1.81e2 SMART
LRR 753 776 2.02e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000139454
AA Change: S158T

PolyPhen 2 Score 0.920 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000139038
Gene: ENSMUSG00000099041
AA Change: S158T

DomainStartEndE-ValueType
Pfam:DUF3733 1 65 3.3e-32 PFAM
Pfam:DUF3733 97 156 2e-22 PFAM
transmembrane domain 320 342 N/A INTRINSIC
low complexity region 445 455 N/A INTRINSIC
internal_repeat_1 461 526 7.6e-5 PROSPERO
low complexity region 540 558 N/A INTRINSIC
LRR 590 613 5.41e0 SMART
LRR 614 636 3.18e2 SMART
LRR 638 660 6.78e1 SMART
LRR_TYP 661 684 1.06e-4 SMART
LRR 685 706 1.15e1 SMART
LRR_TYP 707 730 1.92e-2 SMART
LRR 731 751 1.81e2 SMART
LRR 753 776 2.02e-1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 96% (54/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein belonging to the leucine-rich repeat family of proteins, which are involved in diverse biological processes, including cell adhesion, cellular trafficking, and hormone-receptor interactions. This family member is a putative four-pass transmembrane protein that plays a role in B cell development. Defects in this gene cause autosomal dominant non-Bruton type agammaglobulinemia, an immunodeficiency disease resulting from defects in B cell maturation. Multiple alternatively spliced transcript variants, which encode the same protein, have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous for a knock-out allele exhibit prenatal lethality and premature death, growth retardation, sterility, multiple tissue abnormalities, a severe block in early thymic development, and impaired peripheral T cell function. B cell development is modestly impaired but B cell function is normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik T A 1: 11,588,509 W215R probably damaging Het
Aco1 A G 4: 40,164,747 K79R probably benign Het
Adam28 C T 14: 68,618,127 A630T probably benign Het
Alpk2 T C 18: 65,306,409 K1105E probably benign Het
Angptl1 A T 1: 156,844,693 I30L probably benign Het
Astn1 A T 1: 158,664,122 Q47L probably benign Het
Atf6b T C 17: 34,649,157 S135P probably damaging Het
Ccdc122 G T 14: 77,088,931 probably benign Het
Cers3 T C 7: 66,779,671 probably null Het
Dcaf10 T C 4: 45,373,043 C95R probably damaging Het
Dcxr A G 11: 120,726,091 Y149H probably damaging Het
Dmxl1 A T 18: 49,955,823 I2790F probably damaging Het
Dnhd1 T A 7: 105,703,373 C2578S probably benign Het
Dnttip2 T C 3: 122,276,803 S556P probably damaging Het
Efr3a T G 15: 65,842,686 V301G probably damaging Het
Eml5 A T 12: 98,887,024 H105Q probably damaging Het
Enpp3 T A 10: 24,809,870 H44L probably damaging Het
Fam120a A G 13: 48,934,041 V281A probably damaging Het
Fat3 C T 9: 15,915,061 E4532K possibly damaging Het
Ferd3l G A 12: 33,928,538 V17I probably damaging Het
Glb1l A G 1: 75,201,753 V347A possibly damaging Het
Gm4846 A T 1: 166,494,578 I140N possibly damaging Het
Gm9195 T C 14: 72,434,416 T2586A possibly damaging Het
H2-Ke6 T C 17: 34,027,217 S161G probably damaging Het
Hsp90ab1 T C 17: 45,570,467 I250V probably benign Het
Il11ra1 A G 4: 41,765,454 H183R probably benign Het
Kdelc2 A G 9: 53,392,008 I67V possibly damaging Het
Lama3 G A 18: 12,491,548 C1450Y probably damaging Het
Lgals7 G A 7: 28,865,662 R75Q probably damaging Het
Lpcat3 A G 6: 124,700,011 Y124C probably damaging Het
Mcm3 A T 1: 20,810,096 M504K possibly damaging Het
Mro G T 18: 73,863,932 probably benign Het
Mybpc3 A G 2: 91,125,428 probably null Het
Myh14 T A 7: 44,624,379 K1356* probably null Het
Myo5b A C 18: 74,770,325 Q1804P probably benign Het
Nol10 A G 12: 17,352,727 I67V probably benign Het
Pam T A 1: 97,837,992 I771F probably damaging Het
Pcdhgb8 G T 18: 37,762,089 A71S probably benign Het
Pmfbp1 T C 8: 109,538,675 probably null Het
Poc1b C T 10: 99,192,804 A336V probably benign Het
Prap1 C A 7: 140,095,082 A20E possibly damaging Het
Prox1 G A 1: 190,160,778 A490V probably damaging Het
Prss39 G T 1: 34,498,616 V54F possibly damaging Het
Sema3b T A 9: 107,603,316 E144V probably benign Het
Sft2d1 C T 17: 8,318,875 T32I possibly damaging Het
Smpd2 C T 10: 41,488,446 A160T probably damaging Het
Stard9 G T 2: 120,701,259 V2666F probably damaging Het
Syt7 T A 19: 10,444,144 M400K probably damaging Het
Thoc5 T C 11: 4,919,804 L402P probably damaging Het
Tinf2 A T 14: 55,681,580 M1K probably null Het
Ttc21a A G 9: 119,942,635 I167V probably benign Het
Vldlr T C 19: 27,240,574 L474P probably damaging Het
Xirp2 T C 2: 67,509,950 V845A probably benign Het
Zdhhc7 A T 8: 120,084,924 M180K probably damaging Het
Zfp735 G A 11: 73,710,608 G126D probably damaging Het
Other mutations in Lrrc8a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00693:Lrrc8a APN 2 30255315 missense probably benign 0.32
IGL01161:Lrrc8a APN 2 30255810 missense probably damaging 1.00
IGL01419:Lrrc8a APN 2 30257099 missense probably benign 0.09
IGL01757:Lrrc8a APN 2 30255525 missense possibly damaging 0.81
IGL02390:Lrrc8a APN 2 30256701 missense probably damaging 1.00
IGL02608:Lrrc8a APN 2 30256299 missense possibly damaging 0.91
IGL02938:Lrrc8a APN 2 30255686 missense probably damaging 1.00
IGL02960:Lrrc8a APN 2 30257013 missense probably damaging 1.00
IGL03139:Lrrc8a APN 2 30255671 missense probably damaging 1.00
IGL03166:Lrrc8a APN 2 30255365 missense probably benign
R0033:Lrrc8a UTSW 2 30255345 missense probably damaging 1.00
R0033:Lrrc8a UTSW 2 30255345 missense probably damaging 1.00
R0276:Lrrc8a UTSW 2 30256788 missense possibly damaging 0.54
R0432:Lrrc8a UTSW 2 30257067 missense probably damaging 1.00
R0751:Lrrc8a UTSW 2 30256350 missense possibly damaging 0.82
R1924:Lrrc8a UTSW 2 30255250 missense probably damaging 1.00
R2029:Lrrc8a UTSW 2 30256649 missense probably damaging 1.00
R3852:Lrrc8a UTSW 2 30261960 missense probably benign 0.30
R4898:Lrrc8a UTSW 2 30257202 missense probably benign 0.00
R5175:Lrrc8a UTSW 2 30255512 missense probably damaging 1.00
R5616:Lrrc8a UTSW 2 30255354 missense probably benign 0.09
R5874:Lrrc8a UTSW 2 30257136 missense probably damaging 1.00
R6228:Lrrc8a UTSW 2 30256553 missense possibly damaging 0.82
R6406:Lrrc8a UTSW 2 30257091 missense possibly damaging 0.56
R6456:Lrrc8a UTSW 2 30255474 missense probably benign 0.14
R6834:Lrrc8a UTSW 2 30255647 missense possibly damaging 0.92
R6945:Lrrc8a UTSW 2 30256227 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCCCACAGGTATCAAGTATG -3'
(R):5'- CTTCTCAAACAGGGCCTTCG -3'

Sequencing Primer
(F):5'- GGTATCAAGTATGACCTAGATCGAC -3'
(R):5'- AATCCGTGACTTGGTCCGCTG -3'
Posted On2018-09-12