Incidental Mutation 'R6833:Aco1'
ID534433
Institutional Source Beutler Lab
Gene Symbol Aco1
Ensembl Gene ENSMUSG00000028405
Gene Nameaconitase 1
SynonymsIrp1, Irebp, Aco-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.446) question?
Stock #R6833 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location40143081-40198338 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 40164747 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 79 (K79R)
Ref Sequence ENSEMBL: ENSMUSP00000100038 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102973]
Predicted Effect probably benign
Transcript: ENSMUST00000102973
AA Change: K79R

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000100038
Gene: ENSMUSG00000028405
AA Change: K79R

DomainStartEndE-ValueType
Pfam:Aconitase 54 564 4.5e-180 PFAM
Pfam:Aconitase_C 692 821 1e-48 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 96% (54/56)
MGI Phenotype FUNCTION: This gene encodes a member of the aconitase/IPM isomerase protein family. The encoded protein has been identified as a moonlighting protein based on its ability to perform mechanistically distinct functions. Depending on iron levels in the cytosol, the encoded protein can function as either an aconitase enzyme or as an mRNA binding protein. When cellular iron levels are high, the encoded protein functions as an aconitase, an essential enzyme in the TCA cycle that catalyzes the conversion of citrate to isocitrate. When cellular iron levels are low, the encoded protein regulates iron uptake and utilization by binding to iron-responsive elements in the untranslated regions of mRNAs for genes involved in iron metabolism. Disruption of this gene is associated with pulmonary hypertension and polycythemia. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for disruptions in this gene display no obvious phenotypic abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik T A 1: 11,588,509 W215R probably damaging Het
Adam28 C T 14: 68,618,127 A630T probably benign Het
Alpk2 T C 18: 65,306,409 K1105E probably benign Het
Angptl1 A T 1: 156,844,693 I30L probably benign Het
Astn1 A T 1: 158,664,122 Q47L probably benign Het
Atf6b T C 17: 34,649,157 S135P probably damaging Het
Ccdc122 G T 14: 77,088,931 probably benign Het
Cers3 T C 7: 66,779,671 probably null Het
Dcaf10 T C 4: 45,373,043 C95R probably damaging Het
Dcxr A G 11: 120,726,091 Y149H probably damaging Het
Dmxl1 A T 18: 49,955,823 I2790F probably damaging Het
Dnhd1 T A 7: 105,703,373 C2578S probably benign Het
Dnttip2 T C 3: 122,276,803 S556P probably damaging Het
Efr3a T G 15: 65,842,686 V301G probably damaging Het
Eml5 A T 12: 98,887,024 H105Q probably damaging Het
Enpp3 T A 10: 24,809,870 H44L probably damaging Het
Fam120a A G 13: 48,934,041 V281A probably damaging Het
Fat3 C T 9: 15,915,061 E4532K possibly damaging Het
Ferd3l G A 12: 33,928,538 V17I probably damaging Het
Glb1l A G 1: 75,201,753 V347A possibly damaging Het
Gm4846 A T 1: 166,494,578 I140N possibly damaging Het
Gm9195 T C 14: 72,434,416 T2586A possibly damaging Het
H2-Ke6 T C 17: 34,027,217 S161G probably damaging Het
Hsp90ab1 T C 17: 45,570,467 I250V probably benign Het
Il11ra1 A G 4: 41,765,454 H183R probably benign Het
Kdelc2 A G 9: 53,392,008 I67V possibly damaging Het
Lama3 G A 18: 12,491,548 C1450Y probably damaging Het
Lgals7 G A 7: 28,865,662 R75Q probably damaging Het
Lpcat3 A G 6: 124,700,011 Y124C probably damaging Het
Lrrc8a T A 2: 30,255,647 S158T possibly damaging Het
Mcm3 A T 1: 20,810,096 M504K possibly damaging Het
Mro G T 18: 73,863,932 probably benign Het
Mybpc3 A G 2: 91,125,428 probably null Het
Myh14 T A 7: 44,624,379 K1356* probably null Het
Myo5b A C 18: 74,770,325 Q1804P probably benign Het
Nol10 A G 12: 17,352,727 I67V probably benign Het
Pam T A 1: 97,837,992 I771F probably damaging Het
Pcdhgb8 G T 18: 37,762,089 A71S probably benign Het
Pmfbp1 T C 8: 109,538,675 probably null Het
Poc1b C T 10: 99,192,804 A336V probably benign Het
Prap1 C A 7: 140,095,082 A20E possibly damaging Het
Prox1 G A 1: 190,160,778 A490V probably damaging Het
Prss39 G T 1: 34,498,616 V54F possibly damaging Het
Sema3b T A 9: 107,603,316 E144V probably benign Het
Sft2d1 C T 17: 8,318,875 T32I possibly damaging Het
Smpd2 C T 10: 41,488,446 A160T probably damaging Het
Stard9 G T 2: 120,701,259 V2666F probably damaging Het
Syt7 T A 19: 10,444,144 M400K probably damaging Het
Thoc5 T C 11: 4,919,804 L402P probably damaging Het
Tinf2 A T 14: 55,681,580 M1K probably null Het
Ttc21a A G 9: 119,942,635 I167V probably benign Het
Vldlr T C 19: 27,240,574 L474P probably damaging Het
Xirp2 T C 2: 67,509,950 V845A probably benign Het
Zdhhc7 A T 8: 120,084,924 M180K probably damaging Het
Zfp735 G A 11: 73,710,608 G126D probably damaging Het
Other mutations in Aco1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00813:Aco1 APN 4 40180290 critical splice donor site probably null
IGL01081:Aco1 APN 4 40197576 missense probably benign
IGL01364:Aco1 APN 4 40181380 splice site probably null
IGL01733:Aco1 APN 4 40175738 splice site probably benign
IGL02232:Aco1 APN 4 40175996 missense probably damaging 1.00
IGL02709:Aco1 APN 4 40180199 missense possibly damaging 0.86
IGL03164:Aco1 APN 4 40167116 missense probably benign 0.30
IGL03208:Aco1 APN 4 40186424 missense possibly damaging 0.55
IGL03324:Aco1 APN 4 40186363 missense probably benign
IGL03353:Aco1 APN 4 40175893 missense probably damaging 0.99
R0002:Aco1 UTSW 4 40176649 splice site probably benign
R0486:Aco1 UTSW 4 40177783 missense probably damaging 1.00
R0636:Aco1 UTSW 4 40175697 missense probably damaging 1.00
R1344:Aco1 UTSW 4 40179008 missense probably damaging 1.00
R1844:Aco1 UTSW 4 40197566 missense probably benign 0.00
R1889:Aco1 UTSW 4 40164607 critical splice acceptor site probably null
R1932:Aco1 UTSW 4 40176499 missense probably damaging 1.00
R1959:Aco1 UTSW 4 40167193 critical splice donor site probably null
R1965:Aco1 UTSW 4 40175730 missense probably damaging 1.00
R1983:Aco1 UTSW 4 40175845 missense probably benign 0.37
R2072:Aco1 UTSW 4 40183605 missense probably damaging 1.00
R2073:Aco1 UTSW 4 40183605 missense probably damaging 1.00
R2074:Aco1 UTSW 4 40183605 missense probably damaging 1.00
R3155:Aco1 UTSW 4 40182915 missense probably damaging 1.00
R4595:Aco1 UTSW 4 40167139 missense probably benign 0.43
R4999:Aco1 UTSW 4 40176507 missense probably damaging 1.00
R5131:Aco1 UTSW 4 40163797 missense probably benign
R5354:Aco1 UTSW 4 40180290 critical splice donor site probably null
R5380:Aco1 UTSW 4 40177848 missense probably damaging 1.00
R6352:Aco1 UTSW 4 40186367 missense probably benign 0.10
R6353:Aco1 UTSW 4 40186367 missense probably benign 0.10
R6380:Aco1 UTSW 4 40185028 missense probably benign 0.02
R6540:Aco1 UTSW 4 40186367 missense probably benign 0.10
R6751:Aco1 UTSW 4 40188330 intron probably null
R6760:Aco1 UTSW 4 40180210 nonsense probably null
R6834:Aco1 UTSW 4 40164747 missense probably benign 0.00
R7019:Aco1 UTSW 4 40186376 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTGTGAAAAGCAGGTGCC -3'
(R):5'- TCCTGGTTTCTCAGAGACAAAGC -3'

Sequencing Primer
(F):5'- CCCTGTGGTTTGAGGTTATTAATGC -3'
(R):5'- GCTACAGTAAAAACTTTCTTGGGAGG -3'
Posted On2018-09-12