Incidental Mutation 'R6833:Dcaf10'
ID534435
Institutional Source Beutler Lab
Gene Symbol Dcaf10
Ensembl Gene ENSMUSG00000035572
Gene NameDDB1 and CUL4 associated factor 10
SynonymsWdr32
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.200) question?
Stock #R6833 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location45342101-45379759 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 45373043 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 95 (C95R)
Ref Sequence ENSEMBL: ENSMUSP00000121616 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000153803] [ENSMUST00000155551]
Predicted Effect probably damaging
Transcript: ENSMUST00000153803
AA Change: C95R

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000121616
Gene: ENSMUSG00000035572
AA Change: C95R

DomainStartEndE-ValueType
Blast:WD40 1 30 3e-11 BLAST
Blast:WD40 127 165 2e-10 BLAST
WD40 183 222 1.31e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000155551
AA Change: C436R

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000117082
Gene: ENSMUSG00000035572
AA Change: C436R

DomainStartEndE-ValueType
low complexity region 15 46 N/A INTRINSIC
low complexity region 80 107 N/A INTRINSIC
low complexity region 110 132 N/A INTRINSIC
WD40 166 203 1.71e1 SMART
WD40 206 245 7.85e-7 SMART
WD40 249 288 2.59e-7 SMART
WD40 295 334 2.05e1 SMART
low complexity region 352 374 N/A INTRINSIC
Blast:WD40 468 506 3e-10 BLAST
WD40 524 563 1.31e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 96% (54/56)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik T A 1: 11,588,509 W215R probably damaging Het
Aco1 A G 4: 40,164,747 K79R probably benign Het
Adam28 C T 14: 68,618,127 A630T probably benign Het
Alpk2 T C 18: 65,306,409 K1105E probably benign Het
Angptl1 A T 1: 156,844,693 I30L probably benign Het
Astn1 A T 1: 158,664,122 Q47L probably benign Het
Atf6b T C 17: 34,649,157 S135P probably damaging Het
Ccdc122 G T 14: 77,088,931 probably benign Het
Cers3 T C 7: 66,779,671 probably null Het
Dcxr A G 11: 120,726,091 Y149H probably damaging Het
Dmxl1 A T 18: 49,955,823 I2790F probably damaging Het
Dnhd1 T A 7: 105,703,373 C2578S probably benign Het
Dnttip2 T C 3: 122,276,803 S556P probably damaging Het
Efr3a T G 15: 65,842,686 V301G probably damaging Het
Eml5 A T 12: 98,887,024 H105Q probably damaging Het
Enpp3 T A 10: 24,809,870 H44L probably damaging Het
Fam120a A G 13: 48,934,041 V281A probably damaging Het
Fat3 C T 9: 15,915,061 E4532K possibly damaging Het
Ferd3l G A 12: 33,928,538 V17I probably damaging Het
Glb1l A G 1: 75,201,753 V347A possibly damaging Het
Gm4846 A T 1: 166,494,578 I140N possibly damaging Het
Gm9195 T C 14: 72,434,416 T2586A possibly damaging Het
H2-Ke6 T C 17: 34,027,217 S161G probably damaging Het
Hsp90ab1 T C 17: 45,570,467 I250V probably benign Het
Il11ra1 A G 4: 41,765,454 H183R probably benign Het
Kdelc2 A G 9: 53,392,008 I67V possibly damaging Het
Lama3 G A 18: 12,491,548 C1450Y probably damaging Het
Lgals7 G A 7: 28,865,662 R75Q probably damaging Het
Lpcat3 A G 6: 124,700,011 Y124C probably damaging Het
Lrrc8a T A 2: 30,255,647 S158T possibly damaging Het
Mcm3 A T 1: 20,810,096 M504K possibly damaging Het
Mro G T 18: 73,863,932 probably benign Het
Mybpc3 A G 2: 91,125,428 probably null Het
Myh14 T A 7: 44,624,379 K1356* probably null Het
Myo5b A C 18: 74,770,325 Q1804P probably benign Het
Nol10 A G 12: 17,352,727 I67V probably benign Het
Pam T A 1: 97,837,992 I771F probably damaging Het
Pcdhgb8 G T 18: 37,762,089 A71S probably benign Het
Pmfbp1 T C 8: 109,538,675 probably null Het
Poc1b C T 10: 99,192,804 A336V probably benign Het
Prap1 C A 7: 140,095,082 A20E possibly damaging Het
Prox1 G A 1: 190,160,778 A490V probably damaging Het
Prss39 G T 1: 34,498,616 V54F possibly damaging Het
Sema3b T A 9: 107,603,316 E144V probably benign Het
Sft2d1 C T 17: 8,318,875 T32I possibly damaging Het
Smpd2 C T 10: 41,488,446 A160T probably damaging Het
Stard9 G T 2: 120,701,259 V2666F probably damaging Het
Syt7 T A 19: 10,444,144 M400K probably damaging Het
Thoc5 T C 11: 4,919,804 L402P probably damaging Het
Tinf2 A T 14: 55,681,580 M1K probably null Het
Ttc21a A G 9: 119,942,635 I167V probably benign Het
Vldlr T C 19: 27,240,574 L474P probably damaging Het
Xirp2 T C 2: 67,509,950 V845A probably benign Het
Zdhhc7 A T 8: 120,084,924 M180K probably damaging Het
Zfp735 G A 11: 73,710,608 G126D probably damaging Het
Other mutations in Dcaf10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02431:Dcaf10 APN 4 45342630 missense probably benign 0.01
IGL02660:Dcaf10 APN 4 45372769 missense possibly damaging 0.92
R0048:Dcaf10 UTSW 4 45374262 nonsense probably null
R0550:Dcaf10 UTSW 4 45372753 missense probably benign
R0611:Dcaf10 UTSW 4 45373011 missense probably damaging 1.00
R2289:Dcaf10 UTSW 4 45359816 missense probably damaging 1.00
R2973:Dcaf10 UTSW 4 45373957 missense probably benign 0.04
R3610:Dcaf10 UTSW 4 45372962 nonsense probably null
R3735:Dcaf10 UTSW 4 45348117 missense probably benign 0.01
R4655:Dcaf10 UTSW 4 45372769 missense possibly damaging 0.92
R4665:Dcaf10 UTSW 4 45372769 missense possibly damaging 0.92
R4690:Dcaf10 UTSW 4 45372769 missense possibly damaging 0.92
R4724:Dcaf10 UTSW 4 45372769 missense possibly damaging 0.92
R4725:Dcaf10 UTSW 4 45372769 missense possibly damaging 0.92
R4735:Dcaf10 UTSW 4 45372769 missense possibly damaging 0.92
R4743:Dcaf10 UTSW 4 45370409 missense probably damaging 0.98
R5220:Dcaf10 UTSW 4 45373909 missense possibly damaging 0.94
R5254:Dcaf10 UTSW 4 45370415 missense possibly damaging 0.94
R5855:Dcaf10 UTSW 4 45342558 missense probably benign 0.18
R7132:Dcaf10 UTSW 4 45342391 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGTCCTTGGATAACAGAAATCCG -3'
(R):5'- TGCCCAGTTCACAATACCAAGG -3'

Sequencing Primer
(F):5'- TCCTTGGATAACAGAAATCCGAAATC -3'
(R):5'- GTTCACAATACCAAGGCAAGAG -3'
Posted On2018-09-12