Incidental Mutation 'R6833:Thoc5'
ID534451
Institutional Source Beutler Lab
Gene Symbol Thoc5
Ensembl Gene ENSMUSG00000034274
Gene NameTHO complex 5
Synonyms1700060C24Rik, PK1.3, A430085L24Rik, Fmip
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6833 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location4895320-4928867 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 4919804 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 402 (L402P)
Ref Sequence ENSEMBL: ENSMUSP00000099137 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038237] [ENSMUST00000101615] [ENSMUST00000142543]
Predicted Effect probably damaging
Transcript: ENSMUST00000038237
AA Change: L450P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000045580
Gene: ENSMUSG00000034274
AA Change: L450P

DomainStartEndE-ValueType
Pfam:FimP 97 452 1.1e-133 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000101615
AA Change: L402P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099137
Gene: ENSMUSG00000034274
AA Change: L402P

DomainStartEndE-ValueType
low complexity region 34 41 N/A INTRINSIC
Pfam:FimP 48 405 7.5e-142 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142543
SMART Domains Protein: ENSMUSP00000118940
Gene: ENSMUSG00000034274

DomainStartEndE-ValueType
Pfam:FimP 1 301 1.3e-97 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 96% (54/56)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality prior to E5.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik T A 1: 11,588,509 W215R probably damaging Het
Aco1 A G 4: 40,164,747 K79R probably benign Het
Adam28 C T 14: 68,618,127 A630T probably benign Het
Alpk2 T C 18: 65,306,409 K1105E probably benign Het
Angptl1 A T 1: 156,844,693 I30L probably benign Het
Astn1 A T 1: 158,664,122 Q47L probably benign Het
Atf6b T C 17: 34,649,157 S135P probably damaging Het
Ccdc122 G T 14: 77,088,931 probably benign Het
Cers3 T C 7: 66,779,671 probably null Het
Dcaf10 T C 4: 45,373,043 C95R probably damaging Het
Dcxr A G 11: 120,726,091 Y149H probably damaging Het
Dmxl1 A T 18: 49,955,823 I2790F probably damaging Het
Dnhd1 T A 7: 105,703,373 C2578S probably benign Het
Dnttip2 T C 3: 122,276,803 S556P probably damaging Het
Efr3a T G 15: 65,842,686 V301G probably damaging Het
Eml5 A T 12: 98,887,024 H105Q probably damaging Het
Enpp3 T A 10: 24,809,870 H44L probably damaging Het
Fam120a A G 13: 48,934,041 V281A probably damaging Het
Fat3 C T 9: 15,915,061 E4532K possibly damaging Het
Ferd3l G A 12: 33,928,538 V17I probably damaging Het
Glb1l A G 1: 75,201,753 V347A possibly damaging Het
Gm4846 A T 1: 166,494,578 I140N possibly damaging Het
Gm9195 T C 14: 72,434,416 T2586A possibly damaging Het
H2-Ke6 T C 17: 34,027,217 S161G probably damaging Het
Hsp90ab1 T C 17: 45,570,467 I250V probably benign Het
Il11ra1 A G 4: 41,765,454 H183R probably benign Het
Kdelc2 A G 9: 53,392,008 I67V possibly damaging Het
Lama3 G A 18: 12,491,548 C1450Y probably damaging Het
Lgals7 G A 7: 28,865,662 R75Q probably damaging Het
Lpcat3 A G 6: 124,700,011 Y124C probably damaging Het
Lrrc8a T A 2: 30,255,647 S158T possibly damaging Het
Mcm3 A T 1: 20,810,096 M504K possibly damaging Het
Mro G T 18: 73,863,932 probably benign Het
Mybpc3 A G 2: 91,125,428 probably null Het
Myh14 T A 7: 44,624,379 K1356* probably null Het
Myo5b A C 18: 74,770,325 Q1804P probably benign Het
Nol10 A G 12: 17,352,727 I67V probably benign Het
Pam T A 1: 97,837,992 I771F probably damaging Het
Pcdhgb8 G T 18: 37,762,089 A71S probably benign Het
Pmfbp1 T C 8: 109,538,675 probably null Het
Poc1b C T 10: 99,192,804 A336V probably benign Het
Prap1 C A 7: 140,095,082 A20E possibly damaging Het
Prox1 G A 1: 190,160,778 A490V probably damaging Het
Prss39 G T 1: 34,498,616 V54F possibly damaging Het
Sema3b T A 9: 107,603,316 E144V probably benign Het
Sft2d1 C T 17: 8,318,875 T32I possibly damaging Het
Smpd2 C T 10: 41,488,446 A160T probably damaging Het
Stard9 G T 2: 120,701,259 V2666F probably damaging Het
Syt7 T A 19: 10,444,144 M400K probably damaging Het
Tinf2 A T 14: 55,681,580 M1K probably null Het
Ttc21a A G 9: 119,942,635 I167V probably benign Het
Vldlr T C 19: 27,240,574 L474P probably damaging Het
Xirp2 T C 2: 67,509,950 V845A probably benign Het
Zdhhc7 A T 8: 120,084,924 M180K probably damaging Het
Zfp735 G A 11: 73,710,608 G126D probably damaging Het
Other mutations in Thoc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00790:Thoc5 APN 11 4918147 missense probably damaging 0.96
IGL02039:Thoc5 APN 11 4922027 critical splice donor site probably null
IGL02227:Thoc5 APN 11 4926217 missense probably benign 0.02
IGL02970:Thoc5 APN 11 4904201 missense probably damaging 0.99
R0398:Thoc5 UTSW 11 4921978 missense possibly damaging 0.84
R0401:Thoc5 UTSW 11 4902213 utr 5 prime probably benign
R0453:Thoc5 UTSW 11 4918217 missense possibly damaging 0.60
R1223:Thoc5 UTSW 11 4921922 missense probably benign 0.40
R1438:Thoc5 UTSW 11 4911427 splice site probably benign
R1661:Thoc5 UTSW 11 4919792 missense probably benign 0.04
R1665:Thoc5 UTSW 11 4919792 missense probably benign 0.04
R1776:Thoc5 UTSW 11 4914517 splice site probably benign
R1830:Thoc5 UTSW 11 4914608 missense probably benign 0.02
R1912:Thoc5 UTSW 11 4915561 missense probably benign 0.15
R3001:Thoc5 UTSW 11 4928688 missense probably benign
R3002:Thoc5 UTSW 11 4928688 missense probably benign
R3783:Thoc5 UTSW 11 4920372 unclassified probably benign
R4534:Thoc5 UTSW 11 4924807 nonsense probably null
R4619:Thoc5 UTSW 11 4926218 missense probably damaging 0.96
R4747:Thoc5 UTSW 11 4904187 missense probably damaging 0.99
R5106:Thoc5 UTSW 11 4910630 missense probably damaging 1.00
R5310:Thoc5 UTSW 11 4910648 missense probably damaging 1.00
R5914:Thoc5 UTSW 11 4920416 missense possibly damaging 0.58
R5936:Thoc5 UTSW 11 4904133 missense probably damaging 1.00
R6167:Thoc5 UTSW 11 4915497 missense probably benign 0.12
R6209:Thoc5 UTSW 11 4905697 missense probably damaging 1.00
R6243:Thoc5 UTSW 11 4919753 missense possibly damaging 0.59
R6504:Thoc5 UTSW 11 4924815 nonsense probably null
R6874:Thoc5 UTSW 11 4901261 missense probably damaging 1.00
R7048:Thoc5 UTSW 11 4926237 critical splice donor site probably null
R7197:Thoc5 UTSW 11 4915563 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCATTCAGGATGAGCATCAGTC -3'
(R):5'- GGGAAGGCCAAGTCATCTCAAC -3'

Sequencing Primer
(F):5'- ATCAGTCTTGATGTGAGGACAC -3'
(R):5'- TCTCAACACTTGAAGACTAGGTAGG -3'
Posted On2018-09-12