Incidental Mutation 'R6833:Fam120a'
ID534457
Institutional Source Beutler Lab
Gene Symbol Fam120a
Ensembl Gene ENSMUSG00000038014
Gene Namefamily with sequence similarity 120, member A
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6833 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location48879219-48968017 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 48934041 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 281 (V281A)
Ref Sequence ENSEMBL: ENSMUSP00000053877 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060805]
Predicted Effect probably damaging
Transcript: ENSMUST00000060805
AA Change: V281A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000053877
Gene: ENSMUSG00000038014
AA Change: V281A

DomainStartEndE-ValueType
Blast:XPGN 1 112 1e-15 BLAST
low complexity region 348 361 N/A INTRINSIC
low complexity region 453 468 N/A INTRINSIC
low complexity region 852 866 N/A INTRINSIC
low complexity region 881 897 N/A INTRINSIC
low complexity region 959 966 N/A INTRINSIC
low complexity region 972 986 N/A INTRINSIC
low complexity region 996 1006 N/A INTRINSIC
low complexity region 1026 1044 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 96% (54/56)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik T A 1: 11,588,509 W215R probably damaging Het
Aco1 A G 4: 40,164,747 K79R probably benign Het
Adam28 C T 14: 68,618,127 A630T probably benign Het
Alpk2 T C 18: 65,306,409 K1105E probably benign Het
Angptl1 A T 1: 156,844,693 I30L probably benign Het
Astn1 A T 1: 158,664,122 Q47L probably benign Het
Atf6b T C 17: 34,649,157 S135P probably damaging Het
Ccdc122 G T 14: 77,088,931 probably benign Het
Cers3 T C 7: 66,779,671 probably null Het
Dcaf10 T C 4: 45,373,043 C95R probably damaging Het
Dcxr A G 11: 120,726,091 Y149H probably damaging Het
Dmxl1 A T 18: 49,955,823 I2790F probably damaging Het
Dnhd1 T A 7: 105,703,373 C2578S probably benign Het
Dnttip2 T C 3: 122,276,803 S556P probably damaging Het
Efr3a T G 15: 65,842,686 V301G probably damaging Het
Eml5 A T 12: 98,887,024 H105Q probably damaging Het
Enpp3 T A 10: 24,809,870 H44L probably damaging Het
Fat3 C T 9: 15,915,061 E4532K possibly damaging Het
Ferd3l G A 12: 33,928,538 V17I probably damaging Het
Glb1l A G 1: 75,201,753 V347A possibly damaging Het
Gm4846 A T 1: 166,494,578 I140N possibly damaging Het
Gm9195 T C 14: 72,434,416 T2586A possibly damaging Het
H2-Ke6 T C 17: 34,027,217 S161G probably damaging Het
Hsp90ab1 T C 17: 45,570,467 I250V probably benign Het
Il11ra1 A G 4: 41,765,454 H183R probably benign Het
Kdelc2 A G 9: 53,392,008 I67V possibly damaging Het
Lama3 G A 18: 12,491,548 C1450Y probably damaging Het
Lgals7 G A 7: 28,865,662 R75Q probably damaging Het
Lpcat3 A G 6: 124,700,011 Y124C probably damaging Het
Lrrc8a T A 2: 30,255,647 S158T possibly damaging Het
Mcm3 A T 1: 20,810,096 M504K possibly damaging Het
Mro G T 18: 73,863,932 probably benign Het
Mybpc3 A G 2: 91,125,428 probably null Het
Myh14 T A 7: 44,624,379 K1356* probably null Het
Myo5b A C 18: 74,770,325 Q1804P probably benign Het
Nol10 A G 12: 17,352,727 I67V probably benign Het
Pam T A 1: 97,837,992 I771F probably damaging Het
Pcdhgb8 G T 18: 37,762,089 A71S probably benign Het
Pmfbp1 T C 8: 109,538,675 probably null Het
Poc1b C T 10: 99,192,804 A336V probably benign Het
Prap1 C A 7: 140,095,082 A20E possibly damaging Het
Prox1 G A 1: 190,160,778 A490V probably damaging Het
Prss39 G T 1: 34,498,616 V54F possibly damaging Het
Sema3b T A 9: 107,603,316 E144V probably benign Het
Sft2d1 C T 17: 8,318,875 T32I possibly damaging Het
Smpd2 C T 10: 41,488,446 A160T probably damaging Het
Stard9 G T 2: 120,701,259 V2666F probably damaging Het
Syt7 T A 19: 10,444,144 M400K probably damaging Het
Thoc5 T C 11: 4,919,804 L402P probably damaging Het
Tinf2 A T 14: 55,681,580 M1K probably null Het
Ttc21a A G 9: 119,942,635 I167V probably benign Het
Vldlr T C 19: 27,240,574 L474P probably damaging Het
Xirp2 T C 2: 67,509,950 V845A probably benign Het
Zdhhc7 A T 8: 120,084,924 M180K probably damaging Het
Zfp735 G A 11: 73,710,608 G126D probably damaging Het
Other mutations in Fam120a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00785:Fam120a APN 13 48889133 missense probably benign
IGL01087:Fam120a APN 13 48902073 missense probably damaging 1.00
IGL02052:Fam120a APN 13 48933945 splice site probably benign
IGL02409:Fam120a APN 13 48967359 missense probably benign 0.05
IGL03172:Fam120a APN 13 48910336 missense probably damaging 1.00
Green_flash UTSW 13 48891964 missense probably damaging 1.00
Sunset UTSW 13 48910250 splice site probably null
upended UTSW 13 48897667 missense probably damaging 1.00
R0036:Fam120a UTSW 13 48889264 splice site probably benign
R0042:Fam120a UTSW 13 48934014 missense probably damaging 1.00
R0689:Fam120a UTSW 13 48967638 missense probably damaging 1.00
R0741:Fam120a UTSW 13 48891940 missense possibly damaging 0.91
R0899:Fam120a UTSW 13 48885743 missense possibly damaging 0.70
R0900:Fam120a UTSW 13 48885743 missense possibly damaging 0.70
R0987:Fam120a UTSW 13 48885743 missense possibly damaging 0.70
R0989:Fam120a UTSW 13 48885743 missense possibly damaging 0.70
R0990:Fam120a UTSW 13 48885743 missense possibly damaging 0.70
R1080:Fam120a UTSW 13 48885743 missense possibly damaging 0.70
R1121:Fam120a UTSW 13 48910437 splice site probably null
R1265:Fam120a UTSW 13 48885743 missense possibly damaging 0.70
R1423:Fam120a UTSW 13 48885743 missense possibly damaging 0.70
R1611:Fam120a UTSW 13 48885743 missense possibly damaging 0.70
R1755:Fam120a UTSW 13 48885743 missense possibly damaging 0.70
R1888:Fam120a UTSW 13 48885866 missense possibly damaging 0.50
R1888:Fam120a UTSW 13 48885866 missense possibly damaging 0.50
R2041:Fam120a UTSW 13 48897767 missense probably benign 0.01
R2433:Fam120a UTSW 13 48933968 missense probably damaging 1.00
R2496:Fam120a UTSW 13 48967593 missense probably damaging 0.99
R3122:Fam120a UTSW 13 48892086 missense possibly damaging 0.45
R4279:Fam120a UTSW 13 48889258 missense probably benign 0.00
R4758:Fam120a UTSW 13 48880857 missense probably benign 0.02
R4924:Fam120a UTSW 13 48902096 missense probably benign 0.04
R5000:Fam120a UTSW 13 48897667 missense probably damaging 1.00
R5039:Fam120a UTSW 13 48910250 splice site probably null
R5194:Fam120a UTSW 13 48880935 missense probably benign
R5772:Fam120a UTSW 13 48880933 missense probably benign
R6765:Fam120a UTSW 13 48891964 missense probably damaging 1.00
R6820:Fam120a UTSW 13 48880992 missense possibly damaging 0.51
R6895:Fam120a UTSW 13 48892021 missense probably benign 0.07
R6946:Fam120a UTSW 13 48881020 missense possibly damaging 0.83
R7032:Fam120a UTSW 13 48949113 missense probably benign 0.34
R7081:Fam120a UTSW 13 48910325 missense probably damaging 0.98
R7289:Fam120a UTSW 13 48892006 missense probably damaging 1.00
X0003:Fam120a UTSW 13 48949138 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGAGCACCATAGACTCTGGC -3'
(R):5'- GCCTGCCATGCTTATAGGATC -3'

Sequencing Primer
(F):5'- GAGCACCATAGACTCTGGCATTATC -3'
(R):5'- CCATGCTTATAGGATCATACAGGTGG -3'
Posted On2018-09-12