Incidental Mutation 'R6833:Hsp90ab1'
ID534465
Institutional Source Beutler Lab
Gene Symbol Hsp90ab1
Ensembl Gene ENSMUSG00000023944
Gene Nameheat shock protein 90 alpha (cytosolic), class B member 1
SynonymsHspcb, Hsp84, Hsp90, C81438, Hsp84-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6833 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location45567775-45573271 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 45570467 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 250 (I250V)
Ref Sequence ENSEMBL: ENSMUSP00000024739 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024739] [ENSMUST00000041353] [ENSMUST00000130406] [ENSMUST00000163966] [ENSMUST00000165127] [ENSMUST00000166469] [ENSMUST00000223987] [ENSMUST00000224905] [ENSMUST00000226086]
Predicted Effect probably benign
Transcript: ENSMUST00000024739
AA Change: I250V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000024739
Gene: ENSMUSG00000023944
AA Change: I250V

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
HATPase_c 35 189 3.82e-10 SMART
Pfam:HSP90 191 719 5.4e-246 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000041353
SMART Domains Protein: ENSMUSP00000037834
Gene: ENSMUSG00000037089

DomainStartEndE-ValueType
Pfam:UAA 62 363 5.1e-79 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130406
SMART Domains Protein: ENSMUSP00000119678
Gene: ENSMUSG00000023944

DomainStartEndE-ValueType
SCOP:d1byqa_ 9 76 2e-32 SMART
PDB:1UYM|A 14 76 7e-38 PDB
Blast:HATPase_c 35 76 3e-21 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000163966
SMART Domains Protein: ENSMUSP00000131601
Gene: ENSMUSG00000023944

DomainStartEndE-ValueType
SCOP:d1byqa_ 9 85 9e-40 SMART
PDB:1UYM|A 14 85 3e-45 PDB
Blast:HATPase_c 35 85 9e-29 BLAST
low complexity region 93 107 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165127
SMART Domains Protein: ENSMUSP00000126239
Gene: ENSMUSG00000023944

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
Pfam:HSP90 37 161 3.8e-60 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000166469
AA Change: I37V
SMART Domains Protein: ENSMUSP00000127338
Gene: ENSMUSG00000023944
AA Change: I37V

DomainStartEndE-ValueType
Pfam:HSP90 4 189 1.3e-92 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000223987
Predicted Effect probably benign
Transcript: ENSMUST00000224905
Predicted Effect probably benign
Transcript: ENSMUST00000226086
Meta Mutation Damage Score 0.086 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 96% (54/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the heat shock protein 90 family; these proteins are involved in signal transduction, protein folding and degradation and morphological evolution. This gene encodes the constitutive form of the cytosolic 90 kDa heat-shock protein and is thought to play a role in gastric apoptosis and inflammation. Alternative splicing results in multiple transcript variants. Pseudogenes have been identified on multiple chromosomes. [provided by RefSeq, Dec 2012]
PHENOTYPE: Homozygotes for a gene-trapped null mutation exhibit placental defects including failure to form a placental labyrinth and lack of expansion of allantoic blood vessels. Mutants die around mid-gestation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik T A 1: 11,588,509 W215R probably damaging Het
Aco1 A G 4: 40,164,747 K79R probably benign Het
Adam28 C T 14: 68,618,127 A630T probably benign Het
Alpk2 T C 18: 65,306,409 K1105E probably benign Het
Angptl1 A T 1: 156,844,693 I30L probably benign Het
Astn1 A T 1: 158,664,122 Q47L probably benign Het
Atf6b T C 17: 34,649,157 S135P probably damaging Het
Ccdc122 G T 14: 77,088,931 probably benign Het
Cers3 T C 7: 66,779,671 probably null Het
Dcaf10 T C 4: 45,373,043 C95R probably damaging Het
Dcxr A G 11: 120,726,091 Y149H probably damaging Het
Dmxl1 A T 18: 49,955,823 I2790F probably damaging Het
Dnhd1 T A 7: 105,703,373 C2578S probably benign Het
Dnttip2 T C 3: 122,276,803 S556P probably damaging Het
Efr3a T G 15: 65,842,686 V301G probably damaging Het
Eml5 A T 12: 98,887,024 H105Q probably damaging Het
Enpp3 T A 10: 24,809,870 H44L probably damaging Het
Fam120a A G 13: 48,934,041 V281A probably damaging Het
Fat3 C T 9: 15,915,061 E4532K possibly damaging Het
Ferd3l G A 12: 33,928,538 V17I probably damaging Het
Glb1l A G 1: 75,201,753 V347A possibly damaging Het
Gm4846 A T 1: 166,494,578 I140N possibly damaging Het
Gm9195 T C 14: 72,434,416 T2586A possibly damaging Het
H2-Ke6 T C 17: 34,027,217 S161G probably damaging Het
Il11ra1 A G 4: 41,765,454 H183R probably benign Het
Kdelc2 A G 9: 53,392,008 I67V possibly damaging Het
Lama3 G A 18: 12,491,548 C1450Y probably damaging Het
Lgals7 G A 7: 28,865,662 R75Q probably damaging Het
Lpcat3 A G 6: 124,700,011 Y124C probably damaging Het
Lrrc8a T A 2: 30,255,647 S158T possibly damaging Het
Mcm3 A T 1: 20,810,096 M504K possibly damaging Het
Mro G T 18: 73,863,932 probably benign Het
Mybpc3 A G 2: 91,125,428 probably null Het
Myh14 T A 7: 44,624,379 K1356* probably null Het
Myo5b A C 18: 74,770,325 Q1804P probably benign Het
Nol10 A G 12: 17,352,727 I67V probably benign Het
Pam T A 1: 97,837,992 I771F probably damaging Het
Pcdhgb8 G T 18: 37,762,089 A71S probably benign Het
Pmfbp1 T C 8: 109,538,675 probably null Het
Poc1b C T 10: 99,192,804 A336V probably benign Het
Prap1 C A 7: 140,095,082 A20E possibly damaging Het
Prox1 G A 1: 190,160,778 A490V probably damaging Het
Prss39 G T 1: 34,498,616 V54F possibly damaging Het
Sema3b T A 9: 107,603,316 E144V probably benign Het
Sft2d1 C T 17: 8,318,875 T32I possibly damaging Het
Smpd2 C T 10: 41,488,446 A160T probably damaging Het
Stard9 G T 2: 120,701,259 V2666F probably damaging Het
Syt7 T A 19: 10,444,144 M400K probably damaging Het
Thoc5 T C 11: 4,919,804 L402P probably damaging Het
Tinf2 A T 14: 55,681,580 M1K probably null Het
Ttc21a A G 9: 119,942,635 I167V probably benign Het
Vldlr T C 19: 27,240,574 L474P probably damaging Het
Xirp2 T C 2: 67,509,950 V845A probably benign Het
Zdhhc7 A T 8: 120,084,924 M180K probably damaging Het
Zfp735 G A 11: 73,710,608 G126D probably damaging Het
Other mutations in Hsp90ab1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Hsp90ab1 APN 17 45569564 missense probably damaging 0.96
IGL02234:Hsp90ab1 APN 17 45569735 missense probably benign 0.01
IGL02275:Hsp90ab1 APN 17 45568438 missense possibly damaging 0.76
IGL03069:Hsp90ab1 APN 17 45569028 missense possibly damaging 0.65
IGL03104:Hsp90ab1 APN 17 45571523 missense probably damaging 0.99
R0457:Hsp90ab1 UTSW 17 45568988 missense probably damaging 1.00
R0787:Hsp90ab1 UTSW 17 45569499 unclassified probably benign
R0788:Hsp90ab1 UTSW 17 45569499 unclassified probably benign
R0790:Hsp90ab1 UTSW 17 45569499 unclassified probably benign
R1142:Hsp90ab1 UTSW 17 45568974 nonsense probably null
R1738:Hsp90ab1 UTSW 17 45571806 missense probably damaging 1.00
R2109:Hsp90ab1 UTSW 17 45569328 missense probably benign 0.32
R2156:Hsp90ab1 UTSW 17 45569703 missense possibly damaging 0.82
R2509:Hsp90ab1 UTSW 17 45569341 missense probably damaging 1.00
R3686:Hsp90ab1 UTSW 17 45569288 missense probably damaging 1.00
R3695:Hsp90ab1 UTSW 17 45571477 missense probably damaging 0.98
R3700:Hsp90ab1 UTSW 17 45571514 missense possibly damaging 0.69
R4968:Hsp90ab1 UTSW 17 45571036 missense probably benign 0.05
R5809:Hsp90ab1 UTSW 17 45570649 unclassified probably benign
R6834:Hsp90ab1 UTSW 17 45570467 missense probably benign
R7392:Hsp90ab1 UTSW 17 45569048 missense probably benign 0.10
R7400:Hsp90ab1 UTSW 17 45569284 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GAGGAAGGCTTCTCACCTTG -3'
(R):5'- TTGGAGCAGGCTAATGGCAC -3'

Sequencing Primer
(F):5'- AAGTGGTCCTCCCAGTCATTGG -3'
(R):5'- AGGCTAATGGCACTGGGC -3'
Posted On2018-09-12