Incidental Mutation 'R6834:Cenpf'
ID534482
Institutional Source Beutler Lab
Gene Symbol Cenpf
Ensembl Gene ENSMUSG00000026605
Gene Namecentromere protein F
Synonymsmitosin, 6530404A22Rik, Lek1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.613) question?
Stock #R6834 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location189640606-189688086 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 189659446 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 730 (K730E)
Ref Sequence ENSEMBL: ENSMUSP00000129738 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165962] [ENSMUST00000171929]
Predicted Effect probably damaging
Transcript: ENSMUST00000165962
AA Change: K713E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132759
Gene: ENSMUSG00000026605
AA Change: K713E

DomainStartEndE-ValueType
Pfam:CENP-F_N 1 300 7.3e-135 PFAM
low complexity region 332 347 N/A INTRINSIC
low complexity region 361 379 N/A INTRINSIC
low complexity region 527 540 N/A INTRINSIC
low complexity region 572 592 N/A INTRINSIC
internal_repeat_1 737 759 3.18e-5 PROSPERO
internal_repeat_1 751 773 3.18e-5 PROSPERO
internal_repeat_2 789 804 5.94e-5 PROSPERO
coiled coil region 812 864 N/A INTRINSIC
coiled coil region 885 923 N/A INTRINSIC
low complexity region 925 936 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000171929
AA Change: K730E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129738
Gene: ENSMUSG00000026605
AA Change: K730E

DomainStartEndE-ValueType
Pfam:CENP-F_N 1 300 2.8e-144 PFAM
low complexity region 349 364 N/A INTRINSIC
low complexity region 378 396 N/A INTRINSIC
low complexity region 544 557 N/A INTRINSIC
low complexity region 589 609 N/A INTRINSIC
internal_repeat_5 678 707 8.32e-5 PROSPERO
internal_repeat_3 743 798 2.21e-5 PROSPERO
internal_repeat_1 780 812 2.12e-7 PROSPERO
coiled coil region 829 881 N/A INTRINSIC
coiled coil region 902 1169 N/A INTRINSIC
coiled coil region 1206 1364 N/A INTRINSIC
internal_repeat_2 1381 1413 3.02e-6 PROSPERO
internal_repeat_3 1412 1470 2.21e-5 PROSPERO
low complexity region 1526 1542 N/A INTRINSIC
coiled coil region 1560 1650 N/A INTRINSIC
internal_repeat_2 1655 1687 3.02e-6 PROSPERO
low complexity region 1744 1755 N/A INTRINSIC
coiled coil region 1822 1852 N/A INTRINSIC
Pfam:CENP-F_leu_zip 1893 2035 1.2e-14 PFAM
Pfam:CENP-F_leu_zip 2131 2270 1.5e-47 PFAM
Pfam:CENP-F_leu_zip 2313 2449 1e-46 PFAM
low complexity region 2544 2555 N/A INTRINSIC
low complexity region 2642 2654 N/A INTRINSIC
low complexity region 2755 2769 N/A INTRINSIC
internal_repeat_4 2778 2801 4.28e-5 PROSPERO
low complexity region 2837 2847 N/A INTRINSIC
Pfam:CENP-F_C_Rb_bdg 2850 2896 6.6e-29 PFAM
internal_repeat_1 2935 2964 2.12e-7 PROSPERO
internal_repeat_4 2946 2969 4.28e-5 PROSPERO
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that associates with the centromere-kinetochore complex. The protein is a component of the nuclear matrix during the G2 phase of interphase. In late G2 the protein associates with the kinetochore and maintains this association through early anaphase. It localizes to the spindle midzone and the intracellular bridge in late anaphase and telophase, respectively, and is thought to be subsequently degraded. The localization of this protein suggests that it may play a role in chromosome segregation during mitotis. It is thought to form either a homodimer or heterodimer. Autoantibodies against this protein have been found in patients with cancer or graft versus host disease. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,275,110 W530R possibly damaging Het
Aco1 A G 4: 40,164,747 K79R probably benign Het
Adam15 C T 3: 89,340,083 G426R probably damaging Het
Angptl1 A T 1: 156,844,693 I30L probably benign Het
Ankrd35 A G 3: 96,683,283 E295G possibly damaging Het
Ap5m1 T A 14: 49,073,737 V88E probably damaging Het
Astn1 A T 1: 158,664,122 Q47L probably benign Het
Atf6b T C 17: 34,649,157 S135P probably damaging Het
AU018091 T A 7: 3,157,955 I589F probably benign Het
BC052040 T C 2: 115,674,784 S179P probably benign Het
Chrna6 C T 8: 27,408,310 probably null Het
Dmxl1 A T 18: 49,955,823 I2790F probably damaging Het
Ell A G 8: 70,579,134 D116G probably damaging Het
Eml5 A T 12: 98,887,024 H105Q probably damaging Het
Epb41l2 T A 10: 25,493,604 V23D possibly damaging Het
Gatad2b T A 3: 90,348,643 S139T probably benign Het
Glb1l A G 1: 75,201,753 V347A possibly damaging Het
Gm4846 A T 1: 166,494,578 I140N possibly damaging Het
Gm7534 A C 4: 134,193,165 V563G possibly damaging Het
Gm9268 G C 7: 43,023,580 A143P probably damaging Het
Gng11 A G 6: 4,008,068 I44V probably benign Het
H2-Ke6 T C 17: 34,027,217 S161G probably damaging Het
Hsp90ab1 T C 17: 45,570,467 I250V probably benign Het
Igkv4-79 A G 6: 69,043,272 S20P probably damaging Het
Il11ra1 A G 4: 41,765,454 H183R probably benign Het
Kcnip3 A T 2: 127,458,358 F252I probably damaging Het
Klk11 T C 7: 43,778,912 I242T probably damaging Het
Klk12 T C 7: 43,773,348 V233A possibly damaging Het
Lama3 G A 18: 12,491,548 C1450Y probably damaging Het
Lmod2 A T 6: 24,597,783 probably benign Het
Loxhd1 T A 18: 77,441,526 V1089E probably damaging Het
Lrba C T 3: 86,350,286 P1286S probably benign Het
Lrrc41 T C 4: 116,096,529 V804A possibly damaging Het
Lrrc8a T A 2: 30,255,647 S158T possibly damaging Het
Mcm3 A T 1: 20,810,096 M504K possibly damaging Het
Med24 A T 11: 98,705,024 probably null Het
Mrgprx1 T C 7: 48,021,637 S121G probably damaging Het
Mvb12a G A 8: 71,545,252 M103I probably benign Het
Olfr726 A G 14: 50,084,228 V151A probably damaging Het
Olfr730 T C 14: 50,186,483 I245V probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pacsin3 T A 2: 91,262,835 M224K probably damaging Het
Pam T A 1: 97,837,992 I771F probably damaging Het
Pamr1 C T 2: 102,614,931 R270C probably damaging Het
Pcdhgb8 G T 18: 37,762,089 A71S probably benign Het
Poc1b C T 10: 99,192,804 A336V probably benign Het
Prss39 G T 1: 34,498,616 V54F possibly damaging Het
Ptar1 A G 19: 23,717,924 T252A probably benign Het
Ptprz1 A G 6: 22,999,633 D574G probably benign Het
Rnf40 G A 7: 127,596,406 D635N probably benign Het
Scn1a T A 2: 66,327,742 Q429L probably damaging Het
Sf1 G T 19: 6,374,097 G386C probably damaging Het
Shank2 A T 7: 144,409,894 Y623F probably damaging Het
Slc9a5 G T 8: 105,364,684 A699S probably benign Het
Sox9 A T 11: 112,784,000 Q208L probably benign Het
Synpo2l A T 14: 20,660,634 D865E probably damaging Het
Szt2 A G 4: 118,388,325 S1097P probably benign Het
Tmc1 C A 19: 20,795,610 E676* probably null Het
Ubr3 T C 2: 70,000,481 I158T possibly damaging Het
Ush2a T C 1: 188,356,792 Y315H probably damaging Het
Vmn1r85 T C 7: 13,084,644 D191G probably damaging Het
Zfp358 A G 8: 3,495,613 D92G probably benign Het
Zfp735 G A 11: 73,710,608 G126D probably damaging Het
Other mutations in Cenpf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00778:Cenpf APN 1 189654912 missense probably benign 0.01
IGL01154:Cenpf APN 1 189680333 missense probably benign 0.19
IGL01434:Cenpf APN 1 189657868 nonsense probably null
IGL01461:Cenpf APN 1 189657096 missense probably damaging 1.00
IGL01615:Cenpf APN 1 189653184 missense possibly damaging 0.68
IGL01720:Cenpf APN 1 189682386 missense probably benign 0.05
IGL01720:Cenpf APN 1 189651215 missense probably damaging 0.99
IGL01803:Cenpf APN 1 189654771 nonsense probably null
IGL02152:Cenpf APN 1 189649012 missense probably benign
IGL02222:Cenpf APN 1 189654444 missense probably benign
IGL02338:Cenpf APN 1 189680418 missense probably damaging 1.00
IGL02580:Cenpf APN 1 189657441 missense probably benign 0.20
IGL02629:Cenpf APN 1 189652334 missense probably damaging 1.00
IGL02650:Cenpf APN 1 189652473 missense possibly damaging 0.91
IGL02660:Cenpf APN 1 189654782 missense probably damaging 1.00
IGL02703:Cenpf APN 1 189659758 missense probably benign 0.14
IGL02809:Cenpf APN 1 189682358 splice site probably benign
IGL02851:Cenpf APN 1 189658030 missense probably damaging 1.00
IGL02903:Cenpf APN 1 189646876 missense probably damaging 0.99
IGL03126:Cenpf APN 1 189659010 missense probably damaging 1.00
IGL03235:Cenpf APN 1 189683927 missense probably damaging 1.00
IGL03336:Cenpf APN 1 189652647 missense probably damaging 0.99
IGL03402:Cenpf APN 1 189655076 missense probably damaging 1.00
IGL02799:Cenpf UTSW 1 189659652 missense probably damaging 1.00
R0011:Cenpf UTSW 1 189650706 missense probably benign 0.05
R0129:Cenpf UTSW 1 189659650 missense probably benign 0.26
R0157:Cenpf UTSW 1 189652359 missense probably benign 0.07
R0270:Cenpf UTSW 1 189650714 missense probably benign 0.01
R0607:Cenpf UTSW 1 189682463 splice site probably null
R0621:Cenpf UTSW 1 189672628 missense probably benign
R0639:Cenpf UTSW 1 189658062 missense probably benign 0.01
R0653:Cenpf UTSW 1 189659986 missense probably damaging 1.00
R0718:Cenpf UTSW 1 189653984 missense probably damaging 1.00
R1157:Cenpf UTSW 1 189658453 missense probably benign 0.20
R1331:Cenpf UTSW 1 189642801 missense probably damaging 0.99
R1463:Cenpf UTSW 1 189654739 missense probably damaging 0.97
R1514:Cenpf UTSW 1 189679141 missense possibly damaging 0.67
R1529:Cenpf UTSW 1 189660038 missense probably benign 0.00
R1574:Cenpf UTSW 1 189652713 missense probably damaging 1.00
R1574:Cenpf UTSW 1 189652713 missense probably damaging 1.00
R1662:Cenpf UTSW 1 189657771 missense probably damaging 0.99
R1671:Cenpf UTSW 1 189679144 splice site probably null
R1725:Cenpf UTSW 1 189680479 missense probably damaging 0.99
R1743:Cenpf UTSW 1 189654263 missense probably benign 0.19
R1874:Cenpf UTSW 1 189683816 missense probably damaging 1.00
R1884:Cenpf UTSW 1 189646849 missense probably benign
R1980:Cenpf UTSW 1 189653915 missense probably benign 0.04
R2074:Cenpf UTSW 1 189656901 missense probably damaging 1.00
R2096:Cenpf UTSW 1 189653459 missense possibly damaging 0.95
R2109:Cenpf UTSW 1 189679067 missense probably damaging 0.99
R2113:Cenpf UTSW 1 189679102 missense probably damaging 0.96
R2134:Cenpf UTSW 1 189658642 missense probably benign 0.03
R2209:Cenpf UTSW 1 189652598 missense probably benign 0.04
R2875:Cenpf UTSW 1 189658644 missense probably benign 0.11
R2876:Cenpf UTSW 1 189658644 missense probably benign 0.11
R3433:Cenpf UTSW 1 189659949 missense probably damaging 0.99
R3709:Cenpf UTSW 1 189648812 missense possibly damaging 0.72
R3786:Cenpf UTSW 1 189658337 missense probably damaging 1.00
R4014:Cenpf UTSW 1 189653159 missense probably benign 0.01
R4108:Cenpf UTSW 1 189683868 missense probably damaging 1.00
R4119:Cenpf UTSW 1 189653045 missense probably benign 0.01
R4177:Cenpf UTSW 1 189668619 missense possibly damaging 0.95
R4422:Cenpf UTSW 1 189658350 missense probably damaging 1.00
R4546:Cenpf UTSW 1 189654650 missense probably damaging 1.00
R4592:Cenpf UTSW 1 189679033 missense probably damaging 1.00
R4643:Cenpf UTSW 1 189659589 missense probably benign 0.00
R4650:Cenpf UTSW 1 189660038 missense probably benign 0.00
R4801:Cenpf UTSW 1 189651220 missense probably damaging 1.00
R4802:Cenpf UTSW 1 189651220 missense probably damaging 1.00
R4817:Cenpf UTSW 1 189682369 missense possibly damaging 0.93
R4871:Cenpf UTSW 1 189658531 missense probably damaging 1.00
R5037:Cenpf UTSW 1 189683846 missense probably damaging 1.00
R5106:Cenpf UTSW 1 189683808 missense probably benign 0.00
R5208:Cenpf UTSW 1 189671046 critical splice donor site probably null
R5213:Cenpf UTSW 1 189654980 missense probably benign 0.04
R5237:Cenpf UTSW 1 189659533 missense probably benign 0.28
R5255:Cenpf UTSW 1 189672627 missense possibly damaging 0.49
R5378:Cenpf UTSW 1 189653466 missense possibly damaging 0.95
R5468:Cenpf UTSW 1 189652371 missense probably damaging 1.00
R5510:Cenpf UTSW 1 189682903 missense probably benign 0.14
R5616:Cenpf UTSW 1 189657286 missense probably damaging 1.00
R5652:Cenpf UTSW 1 189657082 missense probably damaging 0.99
R5735:Cenpf UTSW 1 189654363 missense probably benign 0.10
R5841:Cenpf UTSW 1 189657444 missense possibly damaging 0.90
R5943:Cenpf UTSW 1 189659969 missense possibly damaging 0.75
R6082:Cenpf UTSW 1 189658104 missense probably benign 0.11
R6108:Cenpf UTSW 1 189662013 missense probably benign 0.03
R6269:Cenpf UTSW 1 189659920 missense probably benign 0.37
R6284:Cenpf UTSW 1 189652742 missense probably damaging 1.00
R6425:Cenpf UTSW 1 189659898 missense probably benign 0.09
R6587:Cenpf UTSW 1 189658374 missense probably damaging 1.00
R6747:Cenpf UTSW 1 189652854 missense probably benign 0.15
R6811:Cenpf UTSW 1 189654542 missense probably benign 0.06
R6951:Cenpf UTSW 1 189653792 missense probably damaging 1.00
R7095:Cenpf UTSW 1 189659176 missense probably benign 0.01
R7128:Cenpf UTSW 1 189684991 missense probably damaging 1.00
R7185:Cenpf UTSW 1 189653489 missense probably damaging 1.00
R7292:Cenpf UTSW 1 189650694 missense probably damaging 1.00
X0025:Cenpf UTSW 1 189653874 missense possibly damaging 0.79
X0066:Cenpf UTSW 1 189657929 missense probably benign 0.23
Z1088:Cenpf UTSW 1 189652931 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGGCTGCTGTTCAAAAGCC -3'
(R):5'- ACAAGTAAGTCCTGACTCTAATGAG -3'

Sequencing Primer
(F):5'- AAAGAGCCTCTCTGATTATCCTCAG -3'
(R):5'- ACTGTGGAGATTAAAAACCTTCAAAG -3'
Posted On2018-09-12