Incidental Mutation 'R6834:Kcnip3'
ID534489
Institutional Source Beutler Lab
Gene Symbol Kcnip3
Ensembl Gene ENSMUSG00000079056
Gene NameKv channel interacting protein 3, calsenilin
SynonymsCsen, KChIP3, R74849, DREAM, 4933407H12Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6834 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location127456498-127522094 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 127458358 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 252 (F252I)
Ref Sequence ENSEMBL: ENSMUSP00000099504 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028850] [ENSMUST00000088538] [ENSMUST00000103215]
PDB Structure
NMR Structure of DREAM [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000028850
AA Change: F280I

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000028850
Gene: ENSMUSG00000079056
AA Change: F280I

DomainStartEndE-ValueType
EFh 158 186 1.74e-1 SMART
EFh 194 222 3.82e-7 SMART
EFh 242 270 3.79e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000088538
AA Change: F226I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000085896
Gene: ENSMUSG00000079056
AA Change: F226I

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 31 44 N/A INTRINSIC
EFh 104 132 1.74e-1 SMART
EFh 140 168 3.82e-7 SMART
EFh 188 216 3.79e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000103215
AA Change: F252I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099504
Gene: ENSMUSG00000079056
AA Change: F252I

DomainStartEndE-ValueType
low complexity region 60 70 N/A INTRINSIC
EFh 130 158 1.74e-1 SMART
EFh 166 194 3.82e-7 SMART
EFh 214 242 3.79e-2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the family of voltage-gated potassium (Kv) channel-interacting proteins, which belong to the recoverin branch of the EF-hand superfamily. Members of this family are small calcium binding proteins containing EF-hand-like domains. They are integral subunit components of native Kv4 channel complexes that may regulate A-type currents, and hence neuronal excitability, in response to changes in intracellular calcium. The encoded protein also functions as a calcium-regulated transcriptional repressor, and interacts with presenilins. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit abnormal spatial learning, hyperactivity, hypophagia, increased sensitivity to shock, and enhanced long term potentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,275,110 W530R possibly damaging Het
Aco1 A G 4: 40,164,747 K79R probably benign Het
Adam15 C T 3: 89,340,083 G426R probably damaging Het
Angptl1 A T 1: 156,844,693 I30L probably benign Het
Ankrd35 A G 3: 96,683,283 E295G possibly damaging Het
Ap5m1 T A 14: 49,073,737 V88E probably damaging Het
Astn1 A T 1: 158,664,122 Q47L probably benign Het
Atf6b T C 17: 34,649,157 S135P probably damaging Het
AU018091 T A 7: 3,157,955 I589F probably benign Het
BC052040 T C 2: 115,674,784 S179P probably benign Het
Cenpf T C 1: 189,659,446 K730E probably damaging Het
Chrna6 C T 8: 27,408,310 probably null Het
Dmxl1 A T 18: 49,955,823 I2790F probably damaging Het
Ell A G 8: 70,579,134 D116G probably damaging Het
Eml5 A T 12: 98,887,024 H105Q probably damaging Het
Epb41l2 T A 10: 25,493,604 V23D possibly damaging Het
Gatad2b T A 3: 90,348,643 S139T probably benign Het
Glb1l A G 1: 75,201,753 V347A possibly damaging Het
Gm4846 A T 1: 166,494,578 I140N possibly damaging Het
Gm7534 A C 4: 134,193,165 V563G possibly damaging Het
Gm9268 G C 7: 43,023,580 A143P probably damaging Het
Gng11 A G 6: 4,008,068 I44V probably benign Het
H2-Ke6 T C 17: 34,027,217 S161G probably damaging Het
Hsp90ab1 T C 17: 45,570,467 I250V probably benign Het
Igkv4-79 A G 6: 69,043,272 S20P probably damaging Het
Il11ra1 A G 4: 41,765,454 H183R probably benign Het
Klk11 T C 7: 43,778,912 I242T probably damaging Het
Klk12 T C 7: 43,773,348 V233A possibly damaging Het
Lama3 G A 18: 12,491,548 C1450Y probably damaging Het
Lmod2 A T 6: 24,597,783 probably benign Het
Loxhd1 T A 18: 77,441,526 V1089E probably damaging Het
Lrba C T 3: 86,350,286 P1286S probably benign Het
Lrrc41 T C 4: 116,096,529 V804A possibly damaging Het
Lrrc8a T A 2: 30,255,647 S158T possibly damaging Het
Mcm3 A T 1: 20,810,096 M504K possibly damaging Het
Med24 A T 11: 98,705,024 probably null Het
Mrgprx1 T C 7: 48,021,637 S121G probably damaging Het
Mvb12a G A 8: 71,545,252 M103I probably benign Het
Olfr726 A G 14: 50,084,228 V151A probably damaging Het
Olfr730 T C 14: 50,186,483 I245V probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pacsin3 T A 2: 91,262,835 M224K probably damaging Het
Pam T A 1: 97,837,992 I771F probably damaging Het
Pamr1 C T 2: 102,614,931 R270C probably damaging Het
Pcdhgb8 G T 18: 37,762,089 A71S probably benign Het
Poc1b C T 10: 99,192,804 A336V probably benign Het
Prss39 G T 1: 34,498,616 V54F possibly damaging Het
Ptar1 A G 19: 23,717,924 T252A probably benign Het
Ptprz1 A G 6: 22,999,633 D574G probably benign Het
Rnf40 G A 7: 127,596,406 D635N probably benign Het
Scn1a T A 2: 66,327,742 Q429L probably damaging Het
Sf1 G T 19: 6,374,097 G386C probably damaging Het
Shank2 A T 7: 144,409,894 Y623F probably damaging Het
Slc9a5 G T 8: 105,364,684 A699S probably benign Het
Sox9 A T 11: 112,784,000 Q208L probably benign Het
Synpo2l A T 14: 20,660,634 D865E probably damaging Het
Szt2 A G 4: 118,388,325 S1097P probably benign Het
Tmc1 C A 19: 20,795,610 E676* probably null Het
Ubr3 T C 2: 70,000,481 I158T possibly damaging Het
Ush2a T C 1: 188,356,792 Y315H probably damaging Het
Vmn1r85 T C 7: 13,084,644 D191G probably damaging Het
Zfp358 A G 8: 3,495,613 D92G probably benign Het
Zfp735 G A 11: 73,710,608 G126D probably damaging Het
Other mutations in Kcnip3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01490:Kcnip3 APN 2 127510879 missense probably benign 0.44
R0277:Kcnip3 UTSW 2 127459979 splice site probably benign
R0410:Kcnip3 UTSW 2 127460066 missense probably damaging 1.00
R0601:Kcnip3 UTSW 2 127458397 splice site probably benign
R1183:Kcnip3 UTSW 2 127465065 missense probably damaging 1.00
R1868:Kcnip3 UTSW 2 127459343 missense probably damaging 1.00
R2265:Kcnip3 UTSW 2 127465061 missense probably benign 0.40
R2443:Kcnip3 UTSW 2 127460063 missense probably damaging 1.00
R3797:Kcnip3 UTSW 2 127482014 missense probably benign 0.01
R5077:Kcnip3 UTSW 2 127465877 missense probably damaging 0.99
R7084:Kcnip3 UTSW 2 127510936 missense probably benign
R7234:Kcnip3 UTSW 2 127521336 missense unknown
Predicted Primers PCR Primer
(F):5'- TTATTGACCTAGGAATAGGCGG -3'
(R):5'- CCTAGGAATGATAGGTTGCACC -3'

Sequencing Primer
(F):5'- CCAGAGGAACCATGTGTGTGTG -3'
(R):5'- GGTTGCACCTTGCCACTTGG -3'
Posted On2018-09-12