Incidental Mutation 'R6836:Cfap44'
ID534591
Institutional Source Beutler Lab
Gene Symbol Cfap44
Ensembl Gene ENSMUSG00000071550
Gene Namecilia and flagella associated protein 44
Synonyms6330444M21Rik, D16Ertd642e, Wdr52
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6836 (G1)
Quality Score191.009
Status Validated
Chromosome16
Chromosomal Location44394796-44482428 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 44404079 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 50 (D50G)
Ref Sequence ENSEMBL: ENSMUSP00000156229 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099742] [ENSMUST00000120049] [ENSMUST00000147988]
Predicted Effect probably damaging
Transcript: ENSMUST00000099742
AA Change: D50G

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000097331
Gene: ENSMUSG00000071550
AA Change: D50G

DomainStartEndE-ValueType
low complexity region 42 64 N/A INTRINSIC
low complexity region 76 92 N/A INTRINSIC
Blast:WD40 161 201 1e-7 BLAST
WD40 204 246 4.58e1 SMART
WD40 249 288 4.62e-1 SMART
Blast:WD40 292 337 2e-15 BLAST
WD40 342 381 4.8e-2 SMART
WD40 447 486 4.95e-4 SMART
WD40 491 532 2.64e2 SMART
WD40 552 591 2.98e-7 SMART
Blast:WD40 595 634 1e-19 BLAST
coiled coil region 669 711 N/A INTRINSIC
WD40 780 820 3.82e1 SMART
WD40 830 872 2.4e-2 SMART
coiled coil region 907 955 N/A INTRINSIC
coiled coil region 1101 1122 N/A INTRINSIC
low complexity region 1266 1295 N/A INTRINSIC
low complexity region 1312 1325 N/A INTRINSIC
coiled coil region 1402 1459 N/A INTRINSIC
low complexity region 1476 1488 N/A INTRINSIC
low complexity region 1489 1523 N/A INTRINSIC
coiled coil region 1543 1607 N/A INTRINSIC
coiled coil region 1630 1731 N/A INTRINSIC
coiled coil region 1795 1822 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120049
AA Change: D50G

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113908
Gene: ENSMUSG00000071550
AA Change: D50G

DomainStartEndE-ValueType
low complexity region 42 64 N/A INTRINSIC
low complexity region 76 92 N/A INTRINSIC
Blast:WD40 161 201 1e-7 BLAST
WD40 204 246 4.58e1 SMART
WD40 249 288 4.62e-1 SMART
Blast:WD40 292 337 2e-15 BLAST
WD40 342 381 4.8e-2 SMART
WD40 447 486 4.95e-4 SMART
WD40 491 532 2.64e2 SMART
WD40 552 591 2.98e-7 SMART
Blast:WD40 595 634 1e-19 BLAST
coiled coil region 669 711 N/A INTRINSIC
WD40 780 820 3.82e1 SMART
WD40 830 872 2.4e-2 SMART
coiled coil region 907 955 N/A INTRINSIC
coiled coil region 1101 1122 N/A INTRINSIC
low complexity region 1266 1295 N/A INTRINSIC
low complexity region 1312 1325 N/A INTRINSIC
coiled coil region 1402 1459 N/A INTRINSIC
low complexity region 1476 1488 N/A INTRINSIC
low complexity region 1489 1523 N/A INTRINSIC
coiled coil region 1543 1607 N/A INTRINSIC
coiled coil region 1630 1731 N/A INTRINSIC
coiled coil region 1795 1822 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000147988
AA Change: D50G

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 100% (62/62)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete male sterility, asthenozoospermia, and teratozoospermia characterized by multiple sperm axonemal defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik A T 7: 131,196,504 I81F possibly damaging Het
Adamtsl2 T C 2: 27,081,706 M1T probably null Het
Aim2 C G 1: 173,463,980 T317R probably damaging Het
Alox8 T C 11: 69,186,505 Y473C probably damaging Het
Alox8 T C 11: 69,189,889 R209G possibly damaging Het
Asb5 A G 8: 54,585,071 M210V probably benign Het
Atp2c2 T A 8: 119,734,415 L249Q probably damaging Het
AU018091 T G 7: 3,164,156 D77A probably damaging Het
Bahcc1 A T 11: 120,271,757 K294* probably null Het
Baz2b C T 2: 59,917,425 R1298Q probably damaging Het
Bivm T A 1: 44,143,136 N501K possibly damaging Het
Bpifb5 T A 2: 154,228,065 I145N probably benign Het
Casq2 A T 3: 102,086,760 N41I probably damaging Het
Ccdc18 T C 5: 108,197,967 L993P probably damaging Het
Clca3a2 T A 3: 144,806,383 I91F probably damaging Het
Crebbp T A 16: 4,180,022 H66L possibly damaging Het
Cyfip2 T C 11: 46,272,640 T321A probably benign Het
Dido1 A G 2: 180,662,307 V1268A probably benign Het
E030030I06Rik A C 10: 22,148,492 V174G probably damaging Het
Gm20730 G T 6: 43,081,833 probably null Het
Gm36176 T C 10: 77,847,142 probably benign Het
Gper1 T A 5: 139,426,680 M260K probably damaging Het
Igfbp2 T C 1: 72,849,658 L89P probably damaging Het
Katnal1 T C 5: 148,894,164 N200S probably damaging Het
Kcnk13 G T 12: 100,061,689 R341L probably damaging Het
Klhl20 T A 1: 161,105,406 E277D probably benign Het
Lingo1 T C 9: 56,619,772 Y517C probably damaging Het
Lrrk1 C T 7: 66,342,779 E82K probably benign Het
Mtor T A 4: 148,489,498 V1275D possibly damaging Het
Ncan C T 8: 70,100,315 S1089N possibly damaging Het
Notch4 C T 17: 34,586,100 T1643I probably damaging Het
Olfr1258 T C 2: 89,930,339 C177R probably damaging Het
Olfr1357 A G 10: 78,612,590 L17P probably damaging Het
Olfr1387 A T 11: 49,460,077 T133S possibly damaging Het
Olfr539 A C 7: 140,668,180 I298L possibly damaging Het
Pcdhgb6 T C 18: 37,742,962 V241A probably benign Het
Phf11b T A 14: 59,328,123 T102S possibly damaging Het
Pkd1 T A 17: 24,581,259 V2998E probably damaging Het
Ppp1r13b T C 12: 111,835,195 S352G probably benign Het
Ptprh C T 7: 4,551,135 V778M probably damaging Het
Ptprz1 C T 6: 23,030,665 Q1008* probably null Het
Ralgapa1 A T 12: 55,604,273 probably null Het
Rbm20 G A 19: 53,814,069 G336E probably damaging Het
Sdsl T C 5: 120,462,102 I77V probably benign Het
Serpina3b G A 12: 104,134,082 E308K probably benign Het
Sfrp5 G A 19: 42,201,710 T101I probably damaging Het
Slc2a13 C T 15: 91,321,632 V451I probably benign Het
Slc6a9 C T 4: 117,867,886 A559V possibly damaging Het
Spg11 C T 2: 122,059,535 A2109T probably damaging Het
Stard9 C T 2: 120,699,843 R2194C probably benign Het
Tfeb T C 17: 47,786,198 probably null Het
Tiam2 T A 17: 3,414,380 I128N probably benign Het
Tmem161b C A 13: 84,222,418 probably benign Het
Tpr T G 1: 150,436,673 probably null Het
Traf3ip1 T C 1: 91,521,000 I456T probably benign Het
Ttll4 T A 1: 74,689,413 D892E probably damaging Het
Ubr1 T A 2: 120,896,675 probably null Het
Vmn2r74 T A 7: 85,957,422 I239F probably benign Het
Wdfy3 C T 5: 101,952,999 V251M probably damaging Het
Xylb T A 9: 119,391,754 L531H probably damaging Het
Zfp960 T A 17: 17,088,172 C383S probably damaging Het
Other mutations in Cfap44
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Cfap44 APN 16 44407404 missense probably damaging 0.99
IGL00952:Cfap44 APN 16 44421275 missense probably benign 0.33
IGL01340:Cfap44 APN 16 44404130 missense probably damaging 1.00
IGL01530:Cfap44 APN 16 44449167 missense probably damaging 1.00
IGL02083:Cfap44 APN 16 44437162 missense probably damaging 1.00
IGL02088:Cfap44 APN 16 44451628 missense possibly damaging 0.59
IGL02142:Cfap44 APN 16 44421144 missense probably benign 0.15
IGL02311:Cfap44 APN 16 44404771 splice site probably benign
IGL02574:Cfap44 APN 16 44481383 missense probably damaging 1.00
IGL02893:Cfap44 APN 16 44416817 missense probably damaging 1.00
IGL02959:Cfap44 APN 16 44470867 splice site probably benign
IGL03291:Cfap44 APN 16 44407311 missense possibly damaging 0.86
feldgrau UTSW 16 44433666 nonsense probably null
I2288:Cfap44 UTSW 16 44449138 nonsense probably null
R0023:Cfap44 UTSW 16 44421220 missense probably benign 0.01
R0023:Cfap44 UTSW 16 44421220 missense probably benign 0.01
R0036:Cfap44 UTSW 16 44439069 missense possibly damaging 0.83
R0139:Cfap44 UTSW 16 44433422 missense possibly damaging 0.90
R0145:Cfap44 UTSW 16 44468372 missense probably damaging 1.00
R0193:Cfap44 UTSW 16 44449210 splice site probably null
R0238:Cfap44 UTSW 16 44422318 missense probably benign
R0238:Cfap44 UTSW 16 44422318 missense probably benign
R0288:Cfap44 UTSW 16 44415894 splice site probably benign
R0367:Cfap44 UTSW 16 44433476 critical splice donor site probably null
R0452:Cfap44 UTSW 16 44431945 missense probably benign 0.01
R0531:Cfap44 UTSW 16 44401426 start codon destroyed probably benign 0.01
R0722:Cfap44 UTSW 16 44404676 missense possibly damaging 0.94
R0801:Cfap44 UTSW 16 44422486 missense probably benign 0.41
R1209:Cfap44 UTSW 16 44422417 missense possibly damaging 0.86
R1215:Cfap44 UTSW 16 44419303 missense probably damaging 1.00
R1385:Cfap44 UTSW 16 44470775 missense probably damaging 1.00
R1400:Cfap44 UTSW 16 44421212 missense probably benign 0.01
R1415:Cfap44 UTSW 16 44481389 missense probably damaging 0.99
R1475:Cfap44 UTSW 16 44433812 splice site probably benign
R1901:Cfap44 UTSW 16 44422374 missense probably benign 0.00
R1902:Cfap44 UTSW 16 44422374 missense probably benign 0.00
R1903:Cfap44 UTSW 16 44422374 missense probably benign 0.00
R2023:Cfap44 UTSW 16 44416012 missense probably benign 0.01
R2126:Cfap44 UTSW 16 44410475 missense probably benign 0.40
R2147:Cfap44 UTSW 16 44451684 missense probably benign 0.31
R2233:Cfap44 UTSW 16 44451525 missense probably benign 0.01
R2439:Cfap44 UTSW 16 44481246 unclassified probably benign
R3015:Cfap44 UTSW 16 44410469 missense probably benign 0.40
R4178:Cfap44 UTSW 16 44451853 missense possibly damaging 0.81
R4421:Cfap44 UTSW 16 44422437 missense probably damaging 1.00
R4516:Cfap44 UTSW 16 44473864 nonsense probably null
R4742:Cfap44 UTSW 16 44449252 intron probably null
R4766:Cfap44 UTSW 16 44415883 splice site probably null
R4810:Cfap44 UTSW 16 44451535 missense probably damaging 0.99
R4955:Cfap44 UTSW 16 44475277 missense possibly damaging 0.75
R5058:Cfap44 UTSW 16 44420204 splice site probably null
R5164:Cfap44 UTSW 16 44481389 missense probably damaging 0.99
R5172:Cfap44 UTSW 16 44449193 missense probably benign
R5344:Cfap44 UTSW 16 44416400 critical splice donor site probably null
R5519:Cfap44 UTSW 16 44404088 missense probably damaging 1.00
R5572:Cfap44 UTSW 16 44481305 missense possibly damaging 0.95
R5601:Cfap44 UTSW 16 44460186 missense probably damaging 1.00
R5625:Cfap44 UTSW 16 44460347 unclassified probably null
R5638:Cfap44 UTSW 16 44455531 missense possibly damaging 0.94
R5727:Cfap44 UTSW 16 44435442 missense probably damaging 0.98
R5950:Cfap44 UTSW 16 44479847 missense probably damaging 0.99
R6057:Cfap44 UTSW 16 44449097 missense probably benign 0.03
R6063:Cfap44 UTSW 16 44429892 missense probably benign 0.00
R6221:Cfap44 UTSW 16 44437186 missense probably benign 0.13
R6277:Cfap44 UTSW 16 44437306 missense probably benign 0.04
R6322:Cfap44 UTSW 16 44433666 nonsense probably null
R6854:Cfap44 UTSW 16 44449028 critical splice acceptor site probably null
R6889:Cfap44 UTSW 16 44404132 missense probably benign 0.03
R7233:Cfap44 UTSW 16 44422408 missense probably damaging 0.99
R7298:Cfap44 UTSW 16 44481412 missense probably benign 0.04
R7332:Cfap44 UTSW 16 44429828 missense probably damaging 1.00
R7410:Cfap44 UTSW 16 44468413 missense probably damaging 1.00
R7456:Cfap44 UTSW 16 44431942 missense probably benign 0.07
R7491:Cfap44 UTSW 16 44470748 missense probably damaging 1.00
V1662:Cfap44 UTSW 16 44449138 nonsense probably null
X0060:Cfap44 UTSW 16 44449074 missense possibly damaging 0.83
Z1088:Cfap44 UTSW 16 44401466 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACTCACAGAGAAGGCCTGATC -3'
(R):5'- GAGTCCACGTCTTGCAGATCTC -3'

Sequencing Primer
(F):5'- GTTCTAGGAAAGTTTGAATAGAGACC -3'
(R):5'- CCCGTTTCCTCGATCTATAAACAG -3'
Posted On2018-09-12