Incidental Mutation 'R6846:Vnn3'
ID534771
Institutional Source Beutler Lab
Gene Symbol Vnn3
Ensembl Gene ENSMUSG00000020010
Gene Namevanin 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R6846 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location23851462-23869843 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 23851722 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 47 (T47A)
Ref Sequence ENSEMBL: ENSMUSP00000020190 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020190]
Predicted Effect probably benign
Transcript: ENSMUST00000020190
AA Change: T47A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000020190
Gene: ENSMUSG00000020010
AA Change: T47A

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:CN_hydrolase 51 296 6.9e-19 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 100% (42/42)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak A G 19: 9,011,857 N3502D possibly damaging Het
AI314180 A G 4: 58,814,081 C1342R possibly damaging Het
Ambn T A 5: 88,461,715 I94K possibly damaging Het
Ank3 A G 10: 69,824,349 H227R probably damaging Het
Arhgap42 G T 9: 9,006,445 P650Q probably damaging Het
Bahcc1 A G 11: 120,271,596 E240G possibly damaging Het
Cd19 T C 7: 126,410,853 E408G probably benign Het
Cdh11 G A 8: 102,664,644 T320I probably damaging Het
Cep131 G A 11: 120,065,691 R944W probably damaging Het
Dgkd T G 1: 87,925,691 probably null Het
Dnaaf1 T A 8: 119,582,662 L163Q probably damaging Het
Etl4 T A 2: 20,744,108 L550Q possibly damaging Het
Evpl T C 11: 116,223,807 E1019G probably damaging Het
Fam120b T C 17: 15,414,829 L601P probably damaging Het
Fhit C A 14: 9,763,762 R172L possibly damaging Het
Hoxa6 T C 6: 52,206,543 H174R possibly damaging Het
Htra4 A G 8: 25,030,545 F367L probably damaging Het
Ighg2c A G 12: 113,288,310 I102T unknown Het
Iws1 T C 18: 32,086,273 probably benign Het
Lats2 A G 14: 57,696,134 V842A probably damaging Het
Limd2 C T 11: 106,159,387 M1I probably null Het
Lrp2 T A 2: 69,518,443 Q728L probably damaging Het
Mcc T A 18: 44,473,640 T400S possibly damaging Het
Mthfd1l A G 10: 4,047,898 D623G probably damaging Het
Myocos T C 1: 162,657,096 probably benign Het
Nat1 G T 8: 67,491,343 A124S probably benign Het
Nfya A T 17: 48,395,687 M62K probably benign Het
Nlgn1 A G 3: 25,436,342 V378A probably damaging Het
Olfr584 T A 7: 103,086,058 I175N possibly damaging Het
Olfr992 A T 2: 85,400,517 N5K probably damaging Het
Pitpnm2 T C 5: 124,131,171 S463G probably benign Het
Serpinb3b T C 1: 107,154,673 E287G probably benign Het
Slc16a13 T C 11: 70,217,835 T390A probably benign Het
Slc7a14 A G 3: 31,224,223 M411T probably damaging Het
Strn A G 17: 78,736,457 F11L probably damaging Het
Swap70 T A 7: 110,255,749 F85L possibly damaging Het
Tanc2 T A 11: 105,798,653 W214R probably benign Het
Tenm3 T C 8: 48,276,738 K1411R probably benign Het
Tmem176a G T 6: 48,843,825 R116L probably damaging Het
Trim71 G T 9: 114,525,047 H296Q probably damaging Het
Vmn1r67 A T 7: 10,446,913 I35L probably benign Het
Zscan10 A T 17: 23,605,607 Q12H probably damaging Het
Other mutations in Vnn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00675:Vnn3 APN 10 23867168 missense possibly damaging 0.77
IGL01300:Vnn3 APN 10 23864365 missense possibly damaging 0.87
IGL01349:Vnn3 APN 10 23851916 missense probably damaging 0.99
IGL02491:Vnn3 APN 10 23865918 missense probably benign 0.11
IGL03256:Vnn3 APN 10 23851800 splice site probably benign
IGL03289:Vnn3 APN 10 23865837 missense possibly damaging 0.92
IGL02799:Vnn3 UTSW 10 23851971 missense possibly damaging 0.64
R0599:Vnn3 UTSW 10 23865705 missense possibly damaging 0.94
R1703:Vnn3 UTSW 10 23865930 missense probably benign
R1753:Vnn3 UTSW 10 23865820 missense probably benign 0.27
R2119:Vnn3 UTSW 10 23864413 missense probably damaging 1.00
R2288:Vnn3 UTSW 10 23864456 missense probably benign 0.03
R4255:Vnn3 UTSW 10 23865822 missense probably benign 0.18
R4458:Vnn3 UTSW 10 23865669 missense probably benign 0.23
R4518:Vnn3 UTSW 10 23867226 missense possibly damaging 0.77
R4545:Vnn3 UTSW 10 23856326 missense probably benign 0.00
R4723:Vnn3 UTSW 10 23851691 missense possibly damaging 0.88
R4791:Vnn3 UTSW 10 23864621 missense probably benign
R4921:Vnn3 UTSW 10 23864575 missense probably benign 0.01
R5152:Vnn3 UTSW 10 23864339 missense probably benign 0.01
R5390:Vnn3 UTSW 10 23851585 start codon destroyed probably null 1.00
R5545:Vnn3 UTSW 10 23867094 missense probably benign 0.00
R6197:Vnn3 UTSW 10 23856289 missense probably damaging 1.00
R6751:Vnn3 UTSW 10 23869625 missense probably benign 0.00
R6917:Vnn3 UTSW 10 23865934 missense possibly damaging 0.50
R7073:Vnn3 UTSW 10 23864413 missense probably damaging 1.00
R7100:Vnn3 UTSW 10 23865942 missense probably damaging 1.00
R7152:Vnn3 UTSW 10 23851615 missense possibly damaging 0.88
R7336:Vnn3 UTSW 10 23851908 missense probably benign 0.42
R7421:Vnn3 UTSW 10 23865768 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- ATATATTCACAGGCAGCTGGC -3'
(R):5'- TGTGCACCCTGCTCAAAACAG -3'

Sequencing Primer
(F):5'- CTGAGATACAGTAGAAGAACCTTCTG -3'
(R):5'- CTGCTCAAAACAGACATGGAAAG -3'
Posted On2018-09-12