Incidental Mutation 'R6847:Akt3'
ID534793
Institutional Source Beutler Lab
Gene Symbol Akt3
Ensembl Gene ENSMUSG00000019699
Gene Namethymoma viral proto-oncogene 3
SynonymsD930002M15Rik, Nmf350, PKB gamma
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.668) question?
Stock #R6847 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location177020073-177258203 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 177031659 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 449 (P449S)
Ref Sequence ENSEMBL: ENSMUSP00000019843 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019843] [ENSMUST00000111159] [ENSMUST00000111160]
Predicted Effect probably damaging
Transcript: ENSMUST00000019843
AA Change: P449S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000019843
Gene: ENSMUSG00000019699
AA Change: P449S

DomainStartEndE-ValueType
PH 6 109 4.81e-16 SMART
S_TKc 148 405 3.53e-106 SMART
S_TK_X 406 467 6.37e-12 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000111159
AA Change: P449S

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000106789
Gene: ENSMUSG00000019699
AA Change: P449S

DomainStartEndE-ValueType
PH 6 109 4.81e-16 SMART
S_TKc 148 405 3.53e-106 SMART
S_TK_X 406 475 2.61e-17 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000111160
AA Change: P449S

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000106790
Gene: ENSMUSG00000019699
AA Change: P449S

DomainStartEndE-ValueType
PH 6 109 4.81e-16 SMART
S_TKc 148 405 3.53e-106 SMART
S_TK_X 406 475 2.61e-17 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the AKT, also called PKB, serine/threonine protein kinase family. AKT kinases are known to be regulators of cell signaling in response to insulin and growth factors. They are involved in a wide variety of biological processes including cell proliferation, differentiation, apoptosis, tumorigenesis, as well as glycogen synthesis and glucose uptake. This kinase has been shown to be stimulated by platelet-derived growth factor (PDGF), insulin, and insulin-like growth factor 1 (IGF1). Alternatively splice transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice exhibit a 20% decrease in brain size and have smaller and fewer cells in the brain. Mice heterozygous for an ENU-induced mutation exhibit increased seizures (sporadic and induced) and increased brain weight and size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810046K07Rik G A 9: 51,290,204 T184M probably damaging Het
Adam26a A G 8: 43,568,428 I675T probably benign Het
Adgrb3 A T 1: 25,093,922 M1121K probably benign Het
Ak9 A G 10: 41,357,801 probably null Het
Akr1c6 T A 13: 4,438,498 C34* probably null Het
Atg2b A T 12: 105,635,788 V1643E probably damaging Het
Atp2c1 T C 9: 105,418,579 I819V probably damaging Het
Casp3 C T 8: 46,636,266 A183V probably benign Het
Cdk1 A T 10: 69,338,528 D288E probably benign Het
Cep131 G A 11: 120,065,691 R944W probably damaging Het
Cep290 A G 10: 100,563,419 K2268E probably damaging Het
Crybg2 A G 4: 134,065,546 E164G probably benign Het
Cubn A C 2: 13,444,253 probably null Het
Dnajc14 A T 10: 128,816,787 E571D possibly damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Eef1b2 A G 1: 63,178,489 E44G probably benign Het
Eml6 C T 11: 29,818,447 V747I probably benign Het
Ext1 T G 15: 53,345,154 Q70H probably benign Het
Gbp2b T A 3: 142,598,179 C12S probably damaging Het
Gbp8 A C 5: 105,031,227 D135E probably benign Het
Gm12886 A T 4: 121,416,719 L100* probably null Het
Gpatch1 A T 7: 35,293,558 probably null Het
Ifit3b A T 19: 34,611,525 M34L probably benign Het
Il12a G T 3: 68,695,566 D160Y probably damaging Het
Klhl2 A G 8: 64,759,782 L241P probably damaging Het
Krt80 T C 15: 101,358,729 E195G probably benign Het
Lgi1 T C 19: 38,301,290 V268A probably damaging Het
Lrrfip1 A T 1: 91,105,128 D216V probably damaging Het
Meis3 A G 7: 16,183,864 N314S probably damaging Het
Muc5ac C T 7: 141,809,744 probably benign Het
Myh15 A T 16: 49,145,088 I1119F possibly damaging Het
Nav2 A T 7: 49,491,456 Q916H probably benign Het
Ncam2 A T 16: 81,432,718 Q22L probably damaging Het
Olfr1474 A T 19: 13,471,038 I23F probably benign Het
P2rx4 G A 5: 122,727,751 V329M probably damaging Het
Peg10 A G 6: 4,754,279 probably benign Het
Pgp T C 17: 24,471,401 L267P probably damaging Het
Prdm2 A C 4: 143,132,950 S1257A probably benign Het
Prr12 T C 7: 45,045,740 N1434S unknown Het
Psmc3ip A T 11: 101,095,173 H40Q probably damaging Het
Ptprc A T 1: 138,088,545 N526K probably damaging Het
Sec63 T A 10: 42,791,253 D138E probably damaging Het
Serpinb13 A G 1: 106,998,933 N220D probably benign Het
Siva1 G A 12: 112,644,910 probably benign Het
Slc39a12 A G 2: 14,449,917 H546R probably damaging Het
Slc7a1 G A 5: 148,334,658 A497V probably benign Het
Smg5 G T 3: 88,342,552 K95N probably damaging Het
Speer1 G A 5: 11,344,167 V78M probably damaging Het
Traj50 T A 14: 54,167,644 probably benign Het
Ubr3 T C 2: 69,983,128 V1261A probably damaging Het
Zc3h11a A T 1: 133,638,962 probably null Het
Other mutations in Akt3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01020:Akt3 APN 1 177130967 splice site probably benign
IGL02348:Akt3 APN 1 177059386 missense probably damaging 0.99
IGL02394:Akt3 APN 1 177059419 missense probably damaging 1.00
IGL03005:Akt3 APN 1 177067227 missense probably damaging 1.00
R0114:Akt3 UTSW 1 177067251 missense probably damaging 1.00
R1403:Akt3 UTSW 1 177131110 splice site probably benign
R1452:Akt3 UTSW 1 177131067 missense possibly damaging 0.93
R1495:Akt3 UTSW 1 177103042 missense probably benign
R1961:Akt3 UTSW 1 177096995 missense probably damaging 0.97
R2062:Akt3 UTSW 1 177102985 missense possibly damaging 0.93
R2064:Akt3 UTSW 1 177102985 missense possibly damaging 0.93
R2066:Akt3 UTSW 1 177102985 missense possibly damaging 0.93
R2068:Akt3 UTSW 1 177102985 missense possibly damaging 0.93
R4155:Akt3 UTSW 1 177096977 missense possibly damaging 0.92
R4937:Akt3 UTSW 1 177050127 missense possibly damaging 0.89
R5097:Akt3 UTSW 1 177248688 missense probably benign 0.01
R5414:Akt3 UTSW 1 177050251 missense probably damaging 0.98
R6336:Akt3 UTSW 1 177031712 missense probably damaging 1.00
R6723:Akt3 UTSW 1 177050190 nonsense probably null
R6752:Akt3 UTSW 1 177050190 nonsense probably null
R6753:Akt3 UTSW 1 177050190 nonsense probably null
R6755:Akt3 UTSW 1 177050190 nonsense probably null
R6765:Akt3 UTSW 1 177050190 nonsense probably null
R6766:Akt3 UTSW 1 177050190 nonsense probably null
R6767:Akt3 UTSW 1 177050190 nonsense probably null
R6782:Akt3 UTSW 1 177050190 nonsense probably null
R6787:Akt3 UTSW 1 177050190 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAGTCTGTTCCTGCTGCTCAG -3'
(R):5'- ACCCTGTCTGCCTTACACAG -3'

Sequencing Primer
(F):5'- GCTCAGCTCTGCCCTCATAGG -3'
(R):5'- ACGCACCTTCTAGTTGTTGGGAC -3'
Posted On2018-09-12