Incidental Mutation 'R6847:Eml6'
ID534822
Institutional Source Beutler Lab
Gene Symbol Eml6
Ensembl Gene ENSMUSG00000044072
Gene Nameechinoderm microtubule associated protein like 6
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.214) question?
Stock #R6847 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location29743048-30026033 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 29818447 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 747 (V747I)
Ref Sequence ENSEMBL: ENSMUSP00000051080 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058902] [ENSMUST00000104962]
Predicted Effect probably benign
Transcript: ENSMUST00000058902
AA Change: V747I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000051080
Gene: ENSMUSG00000044072
AA Change: V747I

DomainStartEndE-ValueType
low complexity region 36 47 N/A INTRINSIC
WD40 49 91 1.79e-1 SMART
WD40 94 136 1.42e-4 SMART
WD40 139 178 5.31e-4 SMART
WD40 184 224 8.84e1 SMART
WD40 225 263 3.75e-4 SMART
WD40 313 353 4.69e-5 SMART
WD40 356 394 2.22e0 SMART
WD40 397 436 1.72e0 SMART
WD40 505 546 1.7e2 SMART
WD40 552 592 4.55e-3 SMART
low complexity region 613 625 N/A INTRINSIC
Pfam:HELP 653 715 1.9e-22 PFAM
WD40 716 757 9.24e-1 SMART
WD40 760 802 6.53e-4 SMART
WD40 805 844 2.98e-1 SMART
WD40 856 891 8.52e1 SMART
WD40 892 929 2.09e-2 SMART
WD40 986 1026 1.18e-1 SMART
WD40 1032 1068 3.44e0 SMART
WD40 1071 1111 2.58e-1 SMART
WD40 1180 1221 9.24e-1 SMART
WD40 1227 1267 3.85e-1 SMART
low complexity region 1280 1291 N/A INTRINSIC
Pfam:HELP 1329 1402 5e-15 PFAM
WD40 1404 1447 2.66e0 SMART
WD40 1450 1492 1.85e0 SMART
WD40 1495 1534 2.97e0 SMART
WD40 1543 1582 7.1e1 SMART
WD40 1584 1629 9.51e1 SMART
WD40 1675 1715 3.05e-4 SMART
WD40 1718 1758 8.84e1 SMART
WD40 1759 1798 7.16e-1 SMART
WD40 1869 1910 1.53e1 SMART
WD40 1916 1956 4.62e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000104962
SMART Domains Protein: ENSMUSP00000100568
Gene: ENSMUSG00000078157

DomainStartEndE-ValueType
ANK 19 50 1.53e3 SMART
ANK 57 87 1.7e-3 SMART
ANK 99 128 3.6e-2 SMART
ANK 132 162 3.31e-1 SMART
ANK 166 195 8.19e-6 SMART
ANK 199 228 7.83e-3 SMART
ANK 231 260 1.8e-2 SMART
low complexity region 297 306 N/A INTRINSIC
low complexity region 434 445 N/A INTRINSIC
low complexity region 496 507 N/A INTRINSIC
ANK 536 578 8.39e-3 SMART
ANK 582 611 3.91e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109452
Meta Mutation Damage Score 0.154 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810046K07Rik G A 9: 51,290,204 T184M probably damaging Het
Adam26a A G 8: 43,568,428 I675T probably benign Het
Adgrb3 A T 1: 25,093,922 M1121K probably benign Het
Ak9 A G 10: 41,357,801 probably null Het
Akr1c6 T A 13: 4,438,498 C34* probably null Het
Akt3 G A 1: 177,031,659 P449S probably damaging Het
Atg2b A T 12: 105,635,788 V1643E probably damaging Het
Atp2c1 T C 9: 105,418,579 I819V probably damaging Het
Casp3 C T 8: 46,636,266 A183V probably benign Het
Cdk1 A T 10: 69,338,528 D288E probably benign Het
Cep131 G A 11: 120,065,691 R944W probably damaging Het
Cep290 A G 10: 100,563,419 K2268E probably damaging Het
Crybg2 A G 4: 134,065,546 E164G probably benign Het
Cubn A C 2: 13,444,253 probably null Het
Dnajc14 A T 10: 128,816,787 E571D possibly damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Eef1b2 A G 1: 63,178,489 E44G probably benign Het
Ext1 T G 15: 53,345,154 Q70H probably benign Het
Gbp2b T A 3: 142,598,179 C12S probably damaging Het
Gbp8 A C 5: 105,031,227 D135E probably benign Het
Gm12886 A T 4: 121,416,719 L100* probably null Het
Gpatch1 A T 7: 35,293,558 probably null Het
Ifit3b A T 19: 34,611,525 M34L probably benign Het
Il12a G T 3: 68,695,566 D160Y probably damaging Het
Klhl2 A G 8: 64,759,782 L241P probably damaging Het
Krt80 T C 15: 101,358,729 E195G probably benign Het
Lgi1 T C 19: 38,301,290 V268A probably damaging Het
Lrrfip1 A T 1: 91,105,128 D216V probably damaging Het
Meis3 A G 7: 16,183,864 N314S probably damaging Het
Muc5ac C T 7: 141,809,744 probably benign Het
Myh15 A T 16: 49,145,088 I1119F possibly damaging Het
Nav2 A T 7: 49,491,456 Q916H probably benign Het
Ncam2 A T 16: 81,432,718 Q22L probably damaging Het
Olfr1474 A T 19: 13,471,038 I23F probably benign Het
P2rx4 G A 5: 122,727,751 V329M probably damaging Het
Peg10 A G 6: 4,754,279 probably benign Het
Pgp T C 17: 24,471,401 L267P probably damaging Het
Prdm2 A C 4: 143,132,950 S1257A probably benign Het
Prr12 T C 7: 45,045,740 N1434S unknown Het
Psmc3ip A T 11: 101,095,173 H40Q probably damaging Het
Ptprc A T 1: 138,088,545 N526K probably damaging Het
Sec63 T A 10: 42,791,253 D138E probably damaging Het
Serpinb13 A G 1: 106,998,933 N220D probably benign Het
Siva1 G A 12: 112,644,910 probably benign Het
Slc39a12 A G 2: 14,449,917 H546R probably damaging Het
Slc7a1 G A 5: 148,334,658 A497V probably benign Het
Smg5 G T 3: 88,342,552 K95N probably damaging Het
Speer1 G A 5: 11,344,167 V78M probably damaging Het
Traj50 T A 14: 54,167,644 probably benign Het
Ubr3 T C 2: 69,983,128 V1261A probably damaging Het
Zc3h11a A T 1: 133,638,962 probably null Het
Other mutations in Eml6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01071:Eml6 APN 11 29850816 critical splice donor site probably null
IGL01407:Eml6 APN 11 29755021 nonsense probably null
IGL01434:Eml6 APN 11 29819090 missense probably damaging 1.00
IGL01578:Eml6 APN 11 29850870 missense probably benign 0.02
IGL01780:Eml6 APN 11 29805175 missense probably benign 0.17
IGL01821:Eml6 APN 11 29821699 missense probably benign 0.00
IGL01837:Eml6 APN 11 29777055 missense probably benign 0.00
IGL01904:Eml6 APN 11 29838613 nonsense probably null
IGL01972:Eml6 APN 11 29838451 missense possibly damaging 0.67
IGL02134:Eml6 APN 11 29759066 missense probably benign 0.13
IGL02192:Eml6 APN 11 29805743 missense probably benign 0.00
IGL02377:Eml6 APN 11 29777282 missense probably damaging 0.98
IGL02584:Eml6 APN 11 29749387 missense probably damaging 0.99
IGL02587:Eml6 APN 11 29784236 missense possibly damaging 0.92
IGL02810:Eml6 APN 11 29849016 missense possibly damaging 0.94
IGL02873:Eml6 APN 11 29880700 missense probably benign 0.10
IGL02880:Eml6 APN 11 29749959 missense probably benign 0.03
IGL03289:Eml6 APN 11 29795328 missense possibly damaging 0.49
IGL03301:Eml6 APN 11 29764083 missense probably benign 0.18
IGL03386:Eml6 APN 11 29749934 missense probably benign
IGL03407:Eml6 APN 11 29906330 missense probably damaging 1.00
PIT4453001:Eml6 UTSW 11 29802489 missense probably damaging 1.00
R0125:Eml6 UTSW 11 29882088 missense probably benign 0.19
R0240:Eml6 UTSW 11 29792367 missense possibly damaging 0.84
R0240:Eml6 UTSW 11 29792367 missense possibly damaging 0.84
R0271:Eml6 UTSW 11 29848949 missense possibly damaging 0.48
R0304:Eml6 UTSW 11 29777441 missense probably benign 0.00
R0415:Eml6 UTSW 11 29749392 missense possibly damaging 0.84
R0449:Eml6 UTSW 11 29893213 missense probably benign 0.01
R0538:Eml6 UTSW 11 29760010 splice site probably benign
R0671:Eml6 UTSW 11 29805065 missense probably benign 0.00
R0766:Eml6 UTSW 11 29831219 splice site probably benign
R0800:Eml6 UTSW 11 29749877 missense probably benign 0.08
R0841:Eml6 UTSW 11 29777430 missense probably benign 0.41
R0879:Eml6 UTSW 11 29850816 critical splice donor site probably null
R1061:Eml6 UTSW 11 29777267 missense probably damaging 1.00
R1145:Eml6 UTSW 11 29777430 missense probably benign 0.41
R1145:Eml6 UTSW 11 29777430 missense probably benign 0.41
R1172:Eml6 UTSW 11 29749824 missense possibly damaging 0.54
R1173:Eml6 UTSW 11 29749824 missense possibly damaging 0.54
R1174:Eml6 UTSW 11 29749824 missense possibly damaging 0.54
R1199:Eml6 UTSW 11 29755044 missense possibly damaging 0.93
R1311:Eml6 UTSW 11 29831088 splice site probably benign
R1312:Eml6 UTSW 11 29831219 splice site probably benign
R1355:Eml6 UTSW 11 29833085 missense probably benign 0.03
R1370:Eml6 UTSW 11 29833085 missense probably benign 0.03
R1457:Eml6 UTSW 11 30024459 missense probably damaging 1.00
R1486:Eml6 UTSW 11 29805114 missense possibly damaging 0.83
R1511:Eml6 UTSW 11 29818374 missense probably damaging 1.00
R1532:Eml6 UTSW 11 29792256 splice site probably null
R1642:Eml6 UTSW 11 29777001 critical splice donor site probably null
R1682:Eml6 UTSW 11 29759065 missense probably benign 0.13
R1687:Eml6 UTSW 11 29833187 missense probably damaging 1.00
R1699:Eml6 UTSW 11 29746282 nonsense probably null
R1796:Eml6 UTSW 11 29881975 missense probably benign 0.19
R1797:Eml6 UTSW 11 29882041 missense probably benign 0.09
R1837:Eml6 UTSW 11 29749802 splice site probably null
R1874:Eml6 UTSW 11 29831136 missense probably damaging 0.99
R1967:Eml6 UTSW 11 30024545 missense probably damaging 1.00
R1969:Eml6 UTSW 11 29833075 missense probably benign
R2007:Eml6 UTSW 11 29848814 critical splice donor site probably null
R2012:Eml6 UTSW 11 29831128 missense possibly damaging 0.85
R2198:Eml6 UTSW 11 29850935 missense probably benign 0.01
R2217:Eml6 UTSW 11 29818907 missense probably damaging 1.00
R2218:Eml6 UTSW 11 29818907 missense probably damaging 1.00
R2403:Eml6 UTSW 11 29802434 missense probably benign 0.05
R2520:Eml6 UTSW 11 29791993 missense probably damaging 1.00
R2937:Eml6 UTSW 11 29833049 splice site probably benign
R2938:Eml6 UTSW 11 29833049 splice site probably benign
R3085:Eml6 UTSW 11 29809332 missense probably damaging 0.96
R3236:Eml6 UTSW 11 29831097 critical splice donor site probably null
R3738:Eml6 UTSW 11 29803137 missense probably benign 0.20
R3739:Eml6 UTSW 11 29803137 missense probably benign 0.20
R3752:Eml6 UTSW 11 29809360 missense probably benign 0.06
R3854:Eml6 UTSW 11 29749905 missense possibly damaging 0.76
R3941:Eml6 UTSW 11 29803167 missense probably damaging 0.98
R4034:Eml6 UTSW 11 29803137 missense probably benign 0.20
R4049:Eml6 UTSW 11 29838577 missense probably damaging 1.00
R4108:Eml6 UTSW 11 29805136 missense probably damaging 0.98
R4657:Eml6 UTSW 11 29805108 missense possibly damaging 0.77
R4662:Eml6 UTSW 11 29777390 missense probably damaging 1.00
R4665:Eml6 UTSW 11 29819007 nonsense probably null
R4721:Eml6 UTSW 11 29838525 missense possibly damaging 0.95
R4729:Eml6 UTSW 11 29833204 missense probably damaging 1.00
R4766:Eml6 UTSW 11 29805757 missense probably benign 0.22
R4810:Eml6 UTSW 11 29755011 missense possibly damaging 0.92
R4831:Eml6 UTSW 11 29777052 nonsense probably null
R5035:Eml6 UTSW 11 29854187 missense probably benign 0.00
R5064:Eml6 UTSW 11 29749300 missense probably benign 0.12
R5103:Eml6 UTSW 11 29850905 missense possibly damaging 0.65
R5121:Eml6 UTSW 11 29744606 missense probably benign 0.03
R5161:Eml6 UTSW 11 30024467 missense probably damaging 0.99
R5211:Eml6 UTSW 11 29854145 missense probably benign 0.02
R5268:Eml6 UTSW 11 29803108 missense probably benign 0.15
R5390:Eml6 UTSW 11 29760096 missense probably damaging 1.00
R5529:Eml6 UTSW 11 29764126 missense probably benign 0.04
R6239:Eml6 UTSW 11 29749275 missense probably damaging 1.00
R6326:Eml6 UTSW 11 29819066 missense probably damaging 1.00
R6395:Eml6 UTSW 11 29809321 missense probably benign 0.00
R6476:Eml6 UTSW 11 29791971 critical splice donor site probably null
R6483:Eml6 UTSW 11 29749875 missense probably benign 0.00
R6701:Eml6 UTSW 11 29785748 missense probably damaging 0.98
R6753:Eml6 UTSW 11 29754987 missense probably damaging 1.00
R6809:Eml6 UTSW 11 29803161 missense probably benign 0.23
R6855:Eml6 UTSW 11 29751381 splice site probably null
R7168:Eml6 UTSW 11 29838529 missense probably benign 0.01
R7175:Eml6 UTSW 11 29784231 missense probably benign 0.00
R7305:Eml6 UTSW 11 29777258 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGGCAAAGAGCTTACCTCATCAG -3'
(R):5'- CTCGCAGTCACAATGAGCTTC -3'

Sequencing Primer
(F):5'- GCTTACCTCATCAGAAACAGAATGAG -3'
(R):5'- GCAGTCACAATGAGCTTCTTAGAAAC -3'
Posted On2018-09-12