Incidental Mutation 'R6848:Gata3'
ID534843
Institutional Source Beutler Lab
Gene Symbol Gata3
Ensembl Gene ENSMUSG00000015619
Gene NameGATA binding protein 3
SynonymsGata-3, jal
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6848 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location9857078-9890034 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 9858528 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 392 (N392Y)
Ref Sequence ENSEMBL: ENSMUSP00000100041 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102976]
PDB Structure
Adjacent GATA DNA binding [X-RAY DIFFRACTION]
Opposite GATA DNA binding [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000102976
AA Change: N392Y

PolyPhen 2 Score 0.878 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000100041
Gene: ENSMUSG00000015619
AA Change: N392Y

DomainStartEndE-ValueType
low complexity region 128 149 N/A INTRINSIC
low complexity region 153 165 N/A INTRINSIC
low complexity region 229 247 N/A INTRINSIC
ZnF_GATA 257 307 3.65e-20 SMART
ZnF_GATA 311 361 2.9e-23 SMART
low complexity region 367 377 N/A INTRINSIC
low complexity region 399 425 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which belongs to the GATA family of transcription factors. The protein contains two GATA-type zinc fingers and is an important regulator of T-cell development and plays an important role in endothelial cell biology. Defects in this gene are the cause of hypoparathyroidism with sensorineural deafness and renal dysplasia. [provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygous inactivation is embryonic lethal and show a variety of embryonic defects. T cell development is impaired when the locus is conditionally. Mice with a spontaneous mutation exhibit partial hair loss and various defects in hair structure and in hair growth cycle regulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap1 T C 11: 69,884,661 N290S probably damaging Het
Acox3 G T 5: 35,592,184 G218C probably damaging Het
Acsf3 G A 8: 122,790,590 G375D probably damaging Het
Adamts9 G T 6: 92,863,354 N568K possibly damaging Het
Akr1cl G A 1: 65,024,769 T87I probably damaging Het
Cacna1s G A 1: 136,092,694 R823Q probably benign Het
Casp16-ps A T 17: 23,551,079 C175* probably null Het
Cast T C 13: 74,695,933 K694R possibly damaging Het
Cep70 G A 9: 99,262,901 R100H probably benign Het
Cep72 C T 13: 74,038,276 A259T possibly damaging Het
Chsy1 T A 7: 66,171,037 M340K probably damaging Het
Col27a1 T C 4: 63,302,371 S182P probably benign Het
Crlf2 A C 5: 109,557,031 F103V possibly damaging Het
Dync2h1 T C 9: 7,159,632 N652S probably benign Het
Ephx4 G A 5: 107,426,918 G274D probably damaging Het
Fer T A 17: 63,991,606 F517I probably damaging Het
Fsip2 A T 2: 82,982,787 H3150L probably benign Het
Gm17660 A G 5: 104,074,737 probably benign Het
Gm5136 A T 10: 108,699,590 V168E probably damaging Het
Gria4 C T 9: 4,793,822 V79M probably damaging Het
Grk3 A C 5: 112,985,775 N60K probably damaging Het
Igf1r T G 7: 68,004,179 I155R probably damaging Het
Igsf9 T C 1: 172,495,762 L681P probably damaging Het
Intu T C 3: 40,694,255 M789T probably benign Het
Kit A T 5: 75,607,212 Q85L probably benign Het
Klhdc2 T A 12: 69,308,976 C325* probably null Het
Mcidas A G 13: 112,993,885 E5G probably benign Het
Mcm5 G T 8: 75,127,290 R724L possibly damaging Het
Nrbp2 G A 15: 76,091,483 probably benign Het
Nrg1 A G 8: 31,818,056 I655T probably damaging Het
Nsun4 T C 4: 116,052,934 D143G possibly damaging Het
Olfr214 T C 6: 116,556,775 S117P probably damaging Het
Olfr610 A G 7: 103,506,457 V163A possibly damaging Het
Olfr74 A T 2: 87,974,170 V165E possibly damaging Het
Opn3 C T 1: 175,663,049 V349M probably damaging Het
Pank2 C A 2: 131,282,626 L297I probably damaging Het
Pcdh20 T A 14: 88,467,254 E870V probably benign Het
Pdcd6 T A 13: 74,309,840 M71L possibly damaging Het
Phkb A T 8: 86,029,617 I847F probably damaging Het
Psmb1 A G 17: 15,477,247 F202S probably benign Het
Pwp2 C G 10: 78,184,293 probably null Het
Rbms3 A G 9: 117,251,741 Y21H probably damaging Het
Rhbdl1 T A 17: 25,836,184 K17* probably null Het
Rp1l1 C A 14: 64,028,218 Q418K possibly damaging Het
Slc22a4 A T 11: 54,007,789 V159E possibly damaging Het
Spata31d1a T C 13: 59,701,963 T784A possibly damaging Het
Tll1 A G 8: 64,098,510 M279T probably damaging Het
Tmem163 A T 1: 127,551,380 V134D probably damaging Het
Top2b A G 14: 16,409,958 N875S possibly damaging Het
Tpd52l1 T C 10: 31,332,857 E205G probably benign Het
Tpsb2 T A 17: 25,367,828 Y271* probably null Het
Ugt3a1 G A 15: 9,280,052 probably null Het
Vmn2r67 T C 7: 85,152,632 M154V probably benign Het
Zfp740 T G 15: 102,208,808 I89S probably benign Het
Other mutations in Gata3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01366:Gata3 APN 2 9877465 missense probably damaging 1.00
IGL03168:Gata3 APN 2 9868814 missense probably damaging 1.00
R0054:Gata3 UTSW 2 9858447 missense probably damaging 1.00
R0123:Gata3 UTSW 2 9874809 missense probably benign 0.11
R0225:Gata3 UTSW 2 9874809 missense probably benign 0.11
R0724:Gata3 UTSW 2 9874575 missense probably benign
R1491:Gata3 UTSW 2 9877390 missense probably damaging 0.96
R1576:Gata3 UTSW 2 9863196 missense probably damaging 0.98
R1608:Gata3 UTSW 2 9874768 nonsense probably null
R1667:Gata3 UTSW 2 9877549 missense possibly damaging 0.95
R3119:Gata3 UTSW 2 9877585 critical splice acceptor site probably null
R3753:Gata3 UTSW 2 9868840 missense probably benign 0.39
R3876:Gata3 UTSW 2 9863143 missense probably damaging 1.00
R5040:Gata3 UTSW 2 9858515 missense probably damaging 1.00
R5292:Gata3 UTSW 2 9868874 missense probably damaging 1.00
R6414:Gata3 UTSW 2 9858434 missense possibly damaging 0.95
R6696:Gata3 UTSW 2 9874492 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTGGAGACTCCTCACGCATG -3'
(R):5'- CTGTGCTACTGTGCAAAAGC -3'

Sequencing Primer
(F):5'- TCACGCATGTGGAGCAG -3'
(R):5'- CCGGAAGATGTCTAGCAA -3'
Posted On2018-09-12