Incidental Mutation 'R6848:Tll1'
ID 534863
Institutional Source Beutler Lab
Gene Symbol Tll1
Ensembl Gene ENSMUSG00000053626
Gene Name tolloid-like
Synonyms Tll-1, b2b2476Clo
MMRRC Submission 045022-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6848 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 64467965-64659305 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 64551544 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Threonine at position 279 (M279T)
Ref Sequence ENSEMBL: ENSMUSP00000070560 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066166]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000066166
AA Change: M279T

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000070560
Gene: ENSMUSG00000053626
AA Change: M279T

DomainStartEndE-ValueType
ZnMc 153 295 4.12e-56 SMART
CUB 349 461 4.12e-44 SMART
CUB 462 574 3.81e-48 SMART
EGF_CA 574 615 2.28e-9 SMART
CUB 618 730 9.11e-46 SMART
EGF_CA 730 770 4.25e-9 SMART
CUB 774 886 2.01e-47 SMART
CUB 887 1003 7.19e-35 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an astacin-like, zinc-dependent, metalloprotease that belongs to the peptidase M12A family. This protease processes procollagen C-propeptides, such as chordin, pro-biglycan and pro-lysyl oxidase. Studies in mice suggest that this gene plays multiple roles in the development of mammalian heart, and is essential for the formation of the interventricular septum. Allelic variants of this gene are associated with atrial septal defect type 6. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2011]
PHENOTYPE: Homozygous null mice are embryonic lethal with death at midgestation from cardiac failure. Cardiac defects include incomplete formation of the ventricular septum and abnormal positioning of the heart and aorta. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap1 T C 11: 69,775,487 (GRCm39) N290S probably damaging Het
Acox3 G T 5: 35,749,528 (GRCm39) G218C probably damaging Het
Acsf3 G A 8: 123,517,329 (GRCm39) G375D probably damaging Het
Adamts9 G T 6: 92,840,335 (GRCm39) N568K possibly damaging Het
Akr1cl G A 1: 65,063,928 (GRCm39) T87I probably damaging Het
Brcc3dc A T 10: 108,535,451 (GRCm39) V168E probably damaging Het
Cacna1s G A 1: 136,020,432 (GRCm39) R823Q probably benign Het
Casp16 A T 17: 23,770,053 (GRCm39) C175* probably null Het
Cast T C 13: 74,844,052 (GRCm39) K694R possibly damaging Het
Cep70 G A 9: 99,144,954 (GRCm39) R100H probably benign Het
Cep72 C T 13: 74,186,395 (GRCm39) A259T possibly damaging Het
Chsy1 T A 7: 65,820,785 (GRCm39) M340K probably damaging Het
Col27a1 T C 4: 63,220,608 (GRCm39) S182P probably benign Het
Crlf2 A C 5: 109,704,897 (GRCm39) F103V possibly damaging Het
Dync2h1 T C 9: 7,159,632 (GRCm39) N652S probably benign Het
Ephx4 G A 5: 107,574,784 (GRCm39) G274D probably damaging Het
Fer T A 17: 64,298,601 (GRCm39) F517I probably damaging Het
Fsip2 A T 2: 82,813,131 (GRCm39) H3150L probably benign Het
Gata3 T A 2: 9,863,339 (GRCm39) N392Y possibly damaging Het
Gria4 C T 9: 4,793,822 (GRCm39) V79M probably damaging Het
Grk3 A C 5: 113,133,641 (GRCm39) N60K probably damaging Het
Idh2 TCCCAGG T 7: 79,748,079 (GRCm39) probably benign Het
Igf1r T G 7: 67,653,927 (GRCm39) I155R probably damaging Het
Igsf9 T C 1: 172,323,329 (GRCm39) L681P probably damaging Het
Intu T C 3: 40,648,685 (GRCm39) M789T probably benign Het
Kit A T 5: 75,767,872 (GRCm39) Q85L probably benign Het
Klhdc2 T A 12: 69,355,750 (GRCm39) C325* probably null Het
Mcidas A G 13: 113,130,419 (GRCm39) E5G probably benign Het
Mcm5 G T 8: 75,853,918 (GRCm39) R724L possibly damaging Het
Nrbp2 G A 15: 75,963,332 (GRCm39) probably benign Het
Nrg1 A G 8: 32,308,084 (GRCm39) I655T probably damaging Het
Nsun4 T C 4: 115,910,131 (GRCm39) D143G possibly damaging Het
Opn3 C T 1: 175,490,615 (GRCm39) V349M probably damaging Het
Or51ag1 A G 7: 103,155,664 (GRCm39) V163A possibly damaging Het
Or5d47 A T 2: 87,804,514 (GRCm39) V165E possibly damaging Het
Or6d14 T C 6: 116,533,736 (GRCm39) S117P probably damaging Het
Pank2 C A 2: 131,124,546 (GRCm39) L297I probably damaging Het
Pcdh20 T A 14: 88,704,690 (GRCm39) E870V probably benign Het
Pdcd6 T A 13: 74,457,959 (GRCm39) M71L possibly damaging Het
Phkb A T 8: 86,756,246 (GRCm39) I847F probably damaging Het
Psmb1 A G 17: 15,697,509 (GRCm39) F202S probably benign Het
Pwp2 C G 10: 78,020,127 (GRCm39) probably null Het
Rbms3 A G 9: 117,080,809 (GRCm39) Y21H probably damaging Het
Rhbdl1 T A 17: 26,055,158 (GRCm39) K17* probably null Het
Rp1l1 C A 14: 64,265,667 (GRCm39) Q418K possibly damaging Het
Scpppq1 A G 5: 104,222,603 (GRCm39) probably benign Het
Slc22a4 A T 11: 53,898,615 (GRCm39) V159E possibly damaging Het
Spata31d1a T C 13: 59,849,777 (GRCm39) T784A possibly damaging Het
Tmem163 A T 1: 127,479,117 (GRCm39) V134D probably damaging Het
Top2b A G 14: 16,409,958 (GRCm38) N875S possibly damaging Het
Tpd52l1 T C 10: 31,208,853 (GRCm39) E205G probably benign Het
Tpsb2 T A 17: 25,586,802 (GRCm39) Y271* probably null Het
Ugt3a1 G A 15: 9,280,138 (GRCm39) probably null Het
Vmn2r67 T C 7: 84,801,840 (GRCm39) M154V probably benign Het
Zfp740 T G 15: 102,117,243 (GRCm39) I89S probably benign Het
Other mutations in Tll1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Tll1 APN 8 64,469,170 (GRCm39) missense probably benign
IGL00583:Tll1 APN 8 64,658,326 (GRCm39) missense probably benign
IGL00767:Tll1 APN 8 64,524,355 (GRCm39) missense probably damaging 1.00
IGL01061:Tll1 APN 8 64,491,488 (GRCm39) critical splice donor site probably null
IGL01077:Tll1 APN 8 64,523,266 (GRCm39) missense probably benign 0.27
IGL01536:Tll1 APN 8 64,527,323 (GRCm39) missense probably damaging 1.00
IGL02137:Tll1 APN 8 64,469,132 (GRCm39) missense possibly damaging 0.73
IGL02168:Tll1 APN 8 64,507,001 (GRCm39) missense possibly damaging 0.50
IGL02378:Tll1 APN 8 64,470,660 (GRCm39) nonsense probably null
IGL02469:Tll1 APN 8 64,523,314 (GRCm39) missense probably benign 0.41
IGL02504:Tll1 APN 8 64,523,271 (GRCm39) missense possibly damaging 0.55
IGL02650:Tll1 APN 8 64,500,031 (GRCm39) splice site probably benign
IGL02937:Tll1 APN 8 64,658,319 (GRCm39) nonsense probably null
IGL03006:Tll1 APN 8 64,527,251 (GRCm39) splice site probably benign
R0518:Tll1 UTSW 8 64,551,505 (GRCm39) missense probably damaging 1.00
R0521:Tll1 UTSW 8 64,551,505 (GRCm39) missense probably damaging 1.00
R0541:Tll1 UTSW 8 64,491,486 (GRCm39) splice site probably null
R0612:Tll1 UTSW 8 64,524,344 (GRCm39) missense possibly damaging 0.91
R0690:Tll1 UTSW 8 64,527,324 (GRCm39) missense probably damaging 0.99
R0738:Tll1 UTSW 8 64,554,984 (GRCm39) missense probably damaging 1.00
R1454:Tll1 UTSW 8 64,491,524 (GRCm39) missense probably benign
R1619:Tll1 UTSW 8 64,509,307 (GRCm39) missense probably benign 0.25
R1625:Tll1 UTSW 8 64,494,476 (GRCm39) missense probably damaging 1.00
R1654:Tll1 UTSW 8 64,570,937 (GRCm39) critical splice donor site probably null
R1663:Tll1 UTSW 8 64,470,720 (GRCm39) missense probably benign 0.08
R1681:Tll1 UTSW 8 64,538,585 (GRCm39) missense possibly damaging 0.93
R1713:Tll1 UTSW 8 64,554,907 (GRCm39) missense probably damaging 0.99
R1908:Tll1 UTSW 8 64,478,141 (GRCm39) missense probably damaging 0.98
R2118:Tll1 UTSW 8 64,538,591 (GRCm39) missense probably benign 0.21
R2121:Tll1 UTSW 8 64,538,591 (GRCm39) missense probably benign 0.21
R2124:Tll1 UTSW 8 64,538,591 (GRCm39) missense probably benign 0.21
R2360:Tll1 UTSW 8 64,504,435 (GRCm39) missense probably damaging 1.00
R2396:Tll1 UTSW 8 64,523,324 (GRCm39) nonsense probably null
R3032:Tll1 UTSW 8 64,551,526 (GRCm39) missense probably damaging 0.96
R3115:Tll1 UTSW 8 64,506,900 (GRCm39) missense probably damaging 1.00
R3889:Tll1 UTSW 8 64,658,258 (GRCm39) missense possibly damaging 0.77
R4126:Tll1 UTSW 8 64,571,048 (GRCm39) missense possibly damaging 0.78
R4182:Tll1 UTSW 8 64,494,545 (GRCm39) missense probably damaging 1.00
R4572:Tll1 UTSW 8 64,509,343 (GRCm39) missense possibly damaging 0.81
R4677:Tll1 UTSW 8 64,504,411 (GRCm39) missense probably benign 0.31
R4811:Tll1 UTSW 8 64,538,507 (GRCm39) missense possibly damaging 0.72
R4904:Tll1 UTSW 8 64,523,233 (GRCm39) missense probably benign 0.00
R4992:Tll1 UTSW 8 64,546,978 (GRCm39) missense probably damaging 0.98
R5061:Tll1 UTSW 8 64,506,983 (GRCm39) missense probably damaging 0.99
R5078:Tll1 UTSW 8 64,546,921 (GRCm39) missense probably damaging 1.00
R5208:Tll1 UTSW 8 64,504,527 (GRCm39) missense probably damaging 0.99
R5283:Tll1 UTSW 8 64,555,000 (GRCm39) missense possibly damaging 0.68
R5399:Tll1 UTSW 8 64,538,522 (GRCm39) missense probably damaging 1.00
R5699:Tll1 UTSW 8 64,570,974 (GRCm39) missense probably damaging 0.98
R5986:Tll1 UTSW 8 64,527,297 (GRCm39) missense probably damaging 0.99
R6019:Tll1 UTSW 8 64,494,525 (GRCm39) missense possibly damaging 0.83
R6046:Tll1 UTSW 8 64,506,925 (GRCm39) nonsense probably null
R6083:Tll1 UTSW 8 64,491,620 (GRCm39) splice site probably null
R6125:Tll1 UTSW 8 64,504,521 (GRCm39) missense probably damaging 1.00
R6222:Tll1 UTSW 8 64,551,568 (GRCm39) missense probably benign 0.18
R6275:Tll1 UTSW 8 64,504,401 (GRCm39) nonsense probably null
R6508:Tll1 UTSW 8 64,551,494 (GRCm39) missense probably damaging 0.99
R6758:Tll1 UTSW 8 64,494,439 (GRCm39) critical splice donor site probably null
R6782:Tll1 UTSW 8 64,524,315 (GRCm39) missense probably benign 0.00
R7057:Tll1 UTSW 8 64,554,915 (GRCm39) missense probably damaging 1.00
R7144:Tll1 UTSW 8 64,577,979 (GRCm39) missense possibly damaging 0.90
R7244:Tll1 UTSW 8 64,478,222 (GRCm39) missense probably benign 0.00
R7336:Tll1 UTSW 8 64,478,176 (GRCm39) missense probably damaging 0.98
R7373:Tll1 UTSW 8 64,504,391 (GRCm39) missense probably damaging 0.98
R7626:Tll1 UTSW 8 64,551,268 (GRCm39) splice site probably null
R7687:Tll1 UTSW 8 64,574,526 (GRCm39) nonsense probably null
R7699:Tll1 UTSW 8 64,546,988 (GRCm39) missense probably benign 0.00
R7700:Tll1 UTSW 8 64,546,988 (GRCm39) missense probably benign 0.00
R7765:Tll1 UTSW 8 64,504,483 (GRCm39) missense probably damaging 1.00
R7790:Tll1 UTSW 8 64,478,271 (GRCm39) nonsense probably null
R7954:Tll1 UTSW 8 64,571,568 (GRCm39) missense probably damaging 1.00
R8710:Tll1 UTSW 8 64,577,940 (GRCm39) missense possibly damaging 0.77
R8792:Tll1 UTSW 8 64,538,499 (GRCm39) missense probably damaging 1.00
R9134:Tll1 UTSW 8 64,469,201 (GRCm39) missense possibly damaging 0.91
R9444:Tll1 UTSW 8 64,469,123 (GRCm39) missense probably damaging 1.00
R9539:Tll1 UTSW 8 64,494,457 (GRCm39) missense probably damaging 1.00
X0020:Tll1 UTSW 8 64,470,662 (GRCm39) missense probably damaging 0.97
Z1176:Tll1 UTSW 8 64,500,197 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTCCACTTTTGACCCAGG -3'
(R):5'- AGAATTAGCTCATTGTTCCACTCC -3'

Sequencing Primer
(F):5'- TGACCCAGGGCAATATTTCTAC -3'
(R):5'- CAACGGCAATACCATATTTC -3'
Posted On 2018-09-12