Incidental Mutation 'R6849:Cnot10'
ID534922
Institutional Source Beutler Lab
Gene Symbol Cnot10
Ensembl Gene ENSMUSG00000056167
Gene NameCCR4-NOT transcription complex, subunit 10
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6849 (G1)
Quality Score210.009
Status Validated
Chromosome9
Chromosomal Location114585878-114640184 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 114631936 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 55 (D55E)
Ref Sequence ENSEMBL: ENSMUSP00000149867 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070117] [ENSMUST00000213955] [ENSMUST00000215155] [ENSMUST00000216785] [ENSMUST00000217148]
Predicted Effect probably benign
Transcript: ENSMUST00000070117
AA Change: D55E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000064840
Gene: ENSMUSG00000056167
AA Change: D55E

DomainStartEndE-ValueType
Blast:TPR 27 60 2e-10 BLAST
coiled coil region 73 107 N/A INTRINSIC
TPR 110 143 4.32e1 SMART
low complexity region 182 198 N/A INTRINSIC
TPR 293 326 3.37e-2 SMART
TPR 355 388 6.75e1 SMART
low complexity region 496 508 N/A INTRINSIC
TPR 643 676 7.87e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000213955
AA Change: D55E

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
Predicted Effect probably benign
Transcript: ENSMUST00000215155
AA Change: D55E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000216785
AA Change: D55E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000217148
AA Change: D55E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (55/55)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022B05Rik G T 8: 124,639,522 Q161K probably damaging Het
4930578I06Rik A T 14: 63,986,238 W30R probably damaging Het
4930578I06Rik G T 14: 63,986,239 N29K probably benign Het
Aldh6a1 A G 12: 84,443,787 V18A probably benign Het
Apoa5 A G 9: 46,270,000 K125E probably benign Het
Bphl T A 13: 34,050,269 probably null Het
C2cd3 T A 7: 100,406,927 V514E probably damaging Het
C530008M17Rik C A 5: 76,857,010 A406E unknown Het
C530008M17Rik C T 5: 76,857,157 A455V unknown Het
Cacna1s G A 1: 136,092,694 R823Q probably benign Het
Cep192 A G 18: 67,812,435 D202G probably benign Het
Chd5 A T 4: 152,378,538 N1420Y probably damaging Het
Cntn1 T A 15: 92,305,246 I803N probably damaging Het
Col7a1 G T 9: 108,975,053 V2217L unknown Het
Cpne9 T G 6: 113,302,118 V491G probably damaging Het
Csnk2a1 C A 2: 152,250,564 H18Q probably benign Het
D130040H23Rik T A 8: 69,302,651 Y253* probably null Het
Dnah14 A T 1: 181,808,945 M4321L probably benign Het
Dnah5 A G 15: 28,278,624 T1122A probably benign Het
Eif4g1 A G 16: 20,680,745 I515V probably benign Het
Fam214a A C 9: 75,009,312 N398H probably damaging Het
Fbn1 T C 2: 125,321,691 K2082E possibly damaging Het
Fstl1 A G 16: 37,821,159 K99R probably benign Het
Gar1 T C 3: 129,829,389 N117S probably damaging Het
Gm3238 A T 10: 77,770,910 probably benign Het
Gm32742 C T 9: 51,138,714 M1528I probably benign Het
H2-T3 T C 17: 36,189,805 I49V probably benign Het
Hyou1 A G 9: 44,387,264 I581V probably damaging Het
Itk T C 11: 46,331,935 N563S probably damaging Het
Lingo1 A G 9: 56,619,616 L563P probably damaging Het
Lipc A G 9: 70,818,847 probably null Het
Map4k3 A C 17: 80,630,413 probably null Het
Mctp2 C T 7: 72,211,718 C393Y probably damaging Het
Mei1 T A 15: 82,079,945 L229M possibly damaging Het
Olfr1501 G T 19: 13,838,839 C111* probably null Het
Olfr309 T C 7: 86,307,040 I24M possibly damaging Het
Pcnx2 A G 8: 125,861,210 V833A probably damaging Het
Pde8b T C 13: 95,047,799 N388D possibly damaging Het
Pi4ka G A 16: 17,303,421 A1197V possibly damaging Het
Psd A G 19: 46,317,746 Y36H probably damaging Het
Scn8a T A 15: 100,955,587 probably null Het
Shisa6 A G 11: 66,525,501 V155A probably benign Het
Slc45a3 T A 1: 131,977,964 C242S probably damaging Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Tmc3 T A 7: 83,586,357 I54K probably damaging Het
Tmprss11g T A 5: 86,496,632 I118F probably benign Het
Ttn T A 2: 76,914,343 D5454V possibly damaging Het
Ube2f A G 1: 91,254,213 probably null Het
Ubr7 T C 12: 102,758,083 S19P probably damaging Het
Vav3 T C 3: 109,521,466 V371A probably damaging Het
Vmn2r28 A G 7: 5,480,807 V798A probably damaging Het
Vmn2r95 T G 17: 18,443,919 C467G probably damaging Het
Vmn2r95 G T 17: 18,443,920 C467F probably damaging Het
Vps13b A G 15: 35,905,309 D3325G probably damaging Het
Wnk2 T C 13: 49,067,358 T1158A probably damaging Het
Zfp616 T A 11: 74,085,450 N848K possibly damaging Het
Other mutations in Cnot10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01313:Cnot10 APN 9 114631855 missense probably benign 0.19
IGL02004:Cnot10 APN 9 114622930 missense probably damaging 1.00
IGL03297:Cnot10 APN 9 114598716 missense possibly damaging 0.87
R0348:Cnot10 UTSW 9 114598770 missense probably benign 0.10
R0390:Cnot10 UTSW 9 114629150 nonsense probably null
R1256:Cnot10 UTSW 9 114610681 missense probably damaging 1.00
R1471:Cnot10 UTSW 9 114591551 missense probably benign 0.00
R1607:Cnot10 UTSW 9 114629095 nonsense probably null
R1721:Cnot10 UTSW 9 114614999 missense probably benign
R1741:Cnot10 UTSW 9 114597824 missense possibly damaging 0.87
R2116:Cnot10 UTSW 9 114626436 missense probably damaging 1.00
R4073:Cnot10 UTSW 9 114622947 missense possibly damaging 0.91
R4074:Cnot10 UTSW 9 114622947 missense possibly damaging 0.91
R4075:Cnot10 UTSW 9 114622947 missense possibly damaging 0.91
R4365:Cnot10 UTSW 9 114631881 nonsense probably null
R4383:Cnot10 UTSW 9 114631881 nonsense probably null
R4385:Cnot10 UTSW 9 114631881 nonsense probably null
R4398:Cnot10 UTSW 9 114631881 nonsense probably null
R4423:Cnot10 UTSW 9 114617920 missense probably damaging 1.00
R4859:Cnot10 UTSW 9 114627464 missense probably damaging 1.00
R4916:Cnot10 UTSW 9 114629134 missense possibly damaging 0.72
R4927:Cnot10 UTSW 9 114617944 missense probably damaging 1.00
R5153:Cnot10 UTSW 9 114613735 missense probably damaging 1.00
R5677:Cnot10 UTSW 9 114629093 missense probably damaging 1.00
R5702:Cnot10 UTSW 9 114629010 missense probably damaging 0.98
R5790:Cnot10 UTSW 9 114625917 splice site probably null
R6190:Cnot10 UTSW 9 114632723 missense probably damaging 1.00
R6353:Cnot10 UTSW 9 114597546 missense probably damaging 1.00
R6463:Cnot10 UTSW 9 114625902 missense probably damaging 1.00
R6819:Cnot10 UTSW 9 114615055 missense probably benign 0.10
R6875:Cnot10 UTSW 9 114615107 missense probably benign 0.00
R7071:Cnot10 UTSW 9 114617719 intron probably null
X0062:Cnot10 UTSW 9 114615134 intron probably null
Predicted Primers PCR Primer
(F):5'- TCTGTCATCAACATCAGGCAAG -3'
(R):5'- ATTGCTATACGTAGGGGACTTC -3'

Sequencing Primer
(F):5'- GTCATCAACATCAGGCAAGAAATAAC -3'
(R):5'- CGTAGGGGACTTCTGCTTTAAAAC -3'
Posted On2018-09-12