Incidental Mutation 'R6849:Aldh6a1'
ID534927
Institutional Source Beutler Lab
Gene Symbol Aldh6a1
Ensembl Gene ENSMUSG00000021238
Gene Namealdehyde dehydrogenase family 6, subfamily A1
SynonymsMmsdh, 1110038I05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.280) question?
Stock #R6849 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location84430717-84451004 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 84443787 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 18 (V18A)
Ref Sequence ENSEMBL: ENSMUSP00000152269 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085192] [ENSMUST00000220491]
Predicted Effect probably benign
Transcript: ENSMUST00000085192
AA Change: V18A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000082288
Gene: ENSMUSG00000021238
AA Change: V18A

DomainStartEndE-ValueType
low complexity region 2 10 N/A INTRINSIC
low complexity region 30 36 N/A INTRINSIC
Pfam:Aldedh 48 512 1.9e-139 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000220491
AA Change: V18A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000221969
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: This gene encodes a member of the aldehyde dehydrogenase protein family. The encoded enzyme is a mitochondrial methylmalonate semialdehyde dehydrogenase that plays a role in the valine and pyrimidine catabolic pathways. This enzyme catalyzes the irreversible oxidative decarboxylation of malonate and methylmalonate semialdehydes to acetyl- and propionyl-CoA. Mutations in the human gene result in Methylmalonate Semialdehyde Dehydrogenase Deficiency, characterized by elevated beta-alanine, 3-hydroxypropionic acid, and both isomers of 3-amino and 3-hydroxyisobutyric acids in urine organic acids. Alternate splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022B05Rik G T 8: 124,639,522 Q161K probably damaging Het
4930578I06Rik A T 14: 63,986,238 W30R probably damaging Het
4930578I06Rik G T 14: 63,986,239 N29K probably benign Het
Apoa5 A G 9: 46,270,000 K125E probably benign Het
Bphl T A 13: 34,050,269 probably null Het
C2cd3 T A 7: 100,406,927 V514E probably damaging Het
C530008M17Rik C A 5: 76,857,010 A406E unknown Het
C530008M17Rik C T 5: 76,857,157 A455V unknown Het
Cacna1s G A 1: 136,092,694 R823Q probably benign Het
Cep192 A G 18: 67,812,435 D202G probably benign Het
Chd5 A T 4: 152,378,538 N1420Y probably damaging Het
Cnot10 A T 9: 114,631,936 D55E probably benign Het
Cntn1 T A 15: 92,305,246 I803N probably damaging Het
Col7a1 G T 9: 108,975,053 V2217L unknown Het
Cpne9 T G 6: 113,302,118 V491G probably damaging Het
Csnk2a1 C A 2: 152,250,564 H18Q probably benign Het
D130040H23Rik T A 8: 69,302,651 Y253* probably null Het
Dnah14 A T 1: 181,808,945 M4321L probably benign Het
Dnah5 A G 15: 28,278,624 T1122A probably benign Het
Eif4g1 A G 16: 20,680,745 I515V probably benign Het
Fam214a A C 9: 75,009,312 N398H probably damaging Het
Fbn1 T C 2: 125,321,691 K2082E possibly damaging Het
Fstl1 A G 16: 37,821,159 K99R probably benign Het
Gar1 T C 3: 129,829,389 N117S probably damaging Het
Gm3238 A T 10: 77,770,910 probably benign Het
Gm32742 C T 9: 51,138,714 M1528I probably benign Het
H2-T3 T C 17: 36,189,805 I49V probably benign Het
Hyou1 A G 9: 44,387,264 I581V probably damaging Het
Itk T C 11: 46,331,935 N563S probably damaging Het
Lingo1 A G 9: 56,619,616 L563P probably damaging Het
Lipc A G 9: 70,818,847 probably null Het
Map4k3 A C 17: 80,630,413 probably null Het
Mctp2 C T 7: 72,211,718 C393Y probably damaging Het
Mei1 T A 15: 82,079,945 L229M possibly damaging Het
Olfr1501 G T 19: 13,838,839 C111* probably null Het
Olfr309 T C 7: 86,307,040 I24M possibly damaging Het
Pcnx2 A G 8: 125,861,210 V833A probably damaging Het
Pde8b T C 13: 95,047,799 N388D possibly damaging Het
Pi4ka G A 16: 17,303,421 A1197V possibly damaging Het
Psd A G 19: 46,317,746 Y36H probably damaging Het
Scn8a T A 15: 100,955,587 probably null Het
Shisa6 A G 11: 66,525,501 V155A probably benign Het
Slc45a3 T A 1: 131,977,964 C242S probably damaging Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Tmc3 T A 7: 83,586,357 I54K probably damaging Het
Tmprss11g T A 5: 86,496,632 I118F probably benign Het
Ttn T A 2: 76,914,343 D5454V possibly damaging Het
Ube2f A G 1: 91,254,213 probably null Het
Ubr7 T C 12: 102,758,083 S19P probably damaging Het
Vav3 T C 3: 109,521,466 V371A probably damaging Het
Vmn2r28 A G 7: 5,480,807 V798A probably damaging Het
Vmn2r95 T G 17: 18,443,919 C467G probably damaging Het
Vmn2r95 G T 17: 18,443,920 C467F probably damaging Het
Vps13b A G 15: 35,905,309 D3325G probably damaging Het
Wnk2 T C 13: 49,067,358 T1158A probably damaging Het
Zfp616 T A 11: 74,085,450 N848K possibly damaging Het
Other mutations in Aldh6a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01700:Aldh6a1 APN 12 84439538 missense probably damaging 1.00
IGL02213:Aldh6a1 APN 12 84432552 intron probably benign
IGL02489:Aldh6a1 APN 12 84433972 missense possibly damaging 0.66
IGL02806:Aldh6a1 APN 12 84439640 missense probably damaging 1.00
IGL02930:Aldh6a1 APN 12 84433982 missense possibly damaging 0.78
IGL03183:Aldh6a1 APN 12 84436440 unclassified probably null
PIT4378001:Aldh6a1 UTSW 12 84441872 missense probably benign 0.01
R0015:Aldh6a1 UTSW 12 84441780 missense probably damaging 1.00
R0506:Aldh6a1 UTSW 12 84433526 missense probably damaging 1.00
R1458:Aldh6a1 UTSW 12 84439663 missense probably null 0.01
R1468:Aldh6a1 UTSW 12 84441770 missense possibly damaging 0.82
R1468:Aldh6a1 UTSW 12 84441770 missense possibly damaging 0.82
R1579:Aldh6a1 UTSW 12 84441848 missense possibly damaging 0.83
R2300:Aldh6a1 UTSW 12 84439529 missense probably damaging 1.00
R4351:Aldh6a1 UTSW 12 84443761 missense probably benign 0.00
R4447:Aldh6a1 UTSW 12 84439709 missense possibly damaging 0.73
R5205:Aldh6a1 UTSW 12 84439644 missense probably damaging 1.00
R5242:Aldh6a1 UTSW 12 84436383 missense probably damaging 1.00
R5443:Aldh6a1 UTSW 12 84437971 splice site probably null
R7001:Aldh6a1 UTSW 12 84441888 missense probably damaging 1.00
R7182:Aldh6a1 UTSW 12 84441831 missense probably benign 0.19
R7417:Aldh6a1 UTSW 12 84441782 missense probably benign 0.01
R7492:Aldh6a1 UTSW 12 84436866 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCTCCGTGGTTAAGAGCA -3'
(R):5'- CTATATGGAATCCAATGCCCTCTTTT -3'

Sequencing Primer
(F):5'- TTCCAGAGGACCCAGGTTCAATTC -3'
(R):5'- TCTGAAGACAGCTACAATGTACTCG -3'
Posted On2018-09-12