Incidental Mutation 'R6851:Osbpl8'
ID534973
Institutional Source Beutler Lab
Gene Symbol Osbpl8
Ensembl Gene ENSMUSG00000020189
Gene Nameoxysterol binding protein-like 8
SynonymsD330025H14Rik, ORP-8
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.271) question?
Stock #R6851 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location111164752-111297249 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 111270618 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 295 (Y295*)
Ref Sequence ENSEMBL: ENSMUSP00000100911 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095310] [ENSMUST00000105275]
Predicted Effect probably null
Transcript: ENSMUST00000095310
AA Change: Y253*
SMART Domains Protein: ENSMUSP00000092948
Gene: ENSMUSG00000020189
AA Change: Y253*

DomainStartEndE-ValueType
low complexity region 43 59 N/A INTRINSIC
coiled coil region 71 102 N/A INTRINSIC
PH 107 225 3.65e-16 SMART
Pfam:Oxysterol_BP 364 715 6.4e-91 PFAM
coiled coil region 789 811 N/A INTRINSIC
transmembrane domain 829 846 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000105275
AA Change: Y295*
SMART Domains Protein: ENSMUSP00000100911
Gene: ENSMUSG00000020189
AA Change: Y295*

DomainStartEndE-ValueType
low complexity region 85 101 N/A INTRINSIC
coiled coil region 113 144 N/A INTRINSIC
PH 149 267 3.65e-16 SMART
Pfam:Oxysterol_BP 406 752 4.6e-91 PFAM
coiled coil region 831 853 N/A INTRINSIC
transmembrane domain 871 888 N/A INTRINSIC
Meta Mutation Damage Score 0.624 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: This gene encodes a member of the oxysterol-binding protein (Osbp) family, a group of intracellular lipid receptors. Like most members, the encoded protein contains an N-terminal pleckstrin homology domain and a highly conserved C-terminal Osbp-like sterol-binding domain. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit elevated of HDL and gender-specific alterations in lipid metabolism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 A T 17: 46,312,419 C856S probably benign Het
Arrdc2 T C 8: 70,838,725 E153G probably damaging Het
BC051142 A T 17: 34,460,172 Y303F possibly damaging Het
BC055324 G A 1: 163,964,767 R554C probably damaging Het
Cacna1d T C 14: 30,042,782 D2033G probably damaging Het
Cacna1s G A 1: 136,092,694 R823Q probably benign Het
Cracr2a A T 6: 127,608,716 D159V probably damaging Het
Defa35 T C 8: 21,065,130 I22T possibly damaging Het
Dgke T C 11: 89,052,483 T227A probably benign Het
Galnt10 G A 11: 57,765,632 R214Q probably damaging Het
Gm11639 G A 11: 105,005,695 R4290K probably benign Het
Gpr180 T C 14: 118,153,625 Y189H probably damaging Het
Hadh A G 3: 131,271,971 S13P possibly damaging Het
Hcn2 T A 10: 79,729,113 probably null Het
Irgm2 T C 11: 58,219,815 S123P possibly damaging Het
Kcnv1 T A 15: 45,109,198 I430F probably damaging Het
Kif13b G A 14: 64,773,065 C1271Y probably damaging Het
Klhdc3 A T 17: 46,678,292 I48N possibly damaging Het
Lama5 G A 2: 180,191,662 P1519L probably damaging Het
Mprip T A 11: 59,759,015 W1182R probably damaging Het
Mycbp2 A T 14: 103,260,194 probably null Het
Olfr1099 T C 2: 86,959,267 T64A possibly damaging Het
Olfr1112 T A 2: 87,192,469 S261T probably benign Het
Olfr1160 T A 2: 88,005,956 H265L probably damaging Het
Olfr339 T A 2: 36,421,820 C141S probably damaging Het
Olfr916 A G 9: 38,658,185 V69A probably benign Het
Pex5 A G 6: 124,403,154 S275P possibly damaging Het
Prrc2c TTGCTGCTGCTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGCTGCTGCTGC 1: 162,709,061 probably benign Het
Sele G T 1: 164,053,952 G543C probably damaging Het
Serpina3k A C 12: 104,345,366 Y401S probably benign Het
Slc13a4 A G 6: 35,301,733 S74P probably damaging Het
Spata31d1a A G 13: 59,703,911 L114P unknown Het
Syne1 G T 10: 5,262,703 C3295* probably null Het
Tepsin G T 11: 120,096,961 H44N probably damaging Het
Tpp1 A T 7: 105,749,712 V170E probably damaging Het
Trav3-1 T C 14: 52,580,971 V34A probably damaging Het
Ush2a T C 1: 188,533,205 V1642A probably benign Het
Vmn1r122 A G 7: 21,133,920 I70T probably benign Het
Vmn2r96 A G 17: 18,582,538 M237V possibly damaging Het
Wdr75 A G 1: 45,823,427 E802G probably benign Het
Zan G A 5: 137,396,191 T4462I unknown Het
Other mutations in Osbpl8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00785:Osbpl8 APN 10 111273044 missense probably benign 0.30
IGL00826:Osbpl8 APN 10 111272320 splice site probably benign
IGL00839:Osbpl8 APN 10 111291510 missense probably benign 0.01
IGL01148:Osbpl8 APN 10 111276563 splice site probably benign
IGL01338:Osbpl8 APN 10 111267747 missense probably damaging 0.99
IGL01927:Osbpl8 APN 10 111270616 missense probably benign 0.00
IGL02378:Osbpl8 APN 10 111282145 missense possibly damaging 0.94
IGL02863:Osbpl8 APN 10 111284425 splice site probably benign
IGL02933:Osbpl8 APN 10 111282130 missense probably damaging 1.00
IGL03075:Osbpl8 APN 10 111291556 missense probably benign 0.01
R0388:Osbpl8 UTSW 10 111272282 missense probably benign
R0725:Osbpl8 UTSW 10 111286240 missense possibly damaging 0.64
R1353:Osbpl8 UTSW 10 111276479 missense probably damaging 0.97
R1434:Osbpl8 UTSW 10 111291581 missense probably benign 0.01
R1803:Osbpl8 UTSW 10 111275049 missense probably damaging 1.00
R1939:Osbpl8 UTSW 10 111289811 missense probably benign 0.19
R2847:Osbpl8 UTSW 10 111269436 missense probably benign 0.27
R2848:Osbpl8 UTSW 10 111269436 missense probably benign 0.27
R2849:Osbpl8 UTSW 10 111269436 missense probably benign 0.27
R2879:Osbpl8 UTSW 10 111269436 missense probably benign 0.27
R2935:Osbpl8 UTSW 10 111269436 missense probably benign 0.27
R3693:Osbpl8 UTSW 10 111269436 missense probably benign 0.27
R4088:Osbpl8 UTSW 10 111289790 missense possibly damaging 0.52
R4374:Osbpl8 UTSW 10 111269419 missense possibly damaging 0.93
R4376:Osbpl8 UTSW 10 111269419 missense possibly damaging 0.93
R4377:Osbpl8 UTSW 10 111269419 missense possibly damaging 0.93
R4621:Osbpl8 UTSW 10 111269418 missense probably benign 0.01
R4622:Osbpl8 UTSW 10 111291496 missense probably benign 0.00
R4851:Osbpl8 UTSW 10 111204800 start codon destroyed probably null 0.00
R5134:Osbpl8 UTSW 10 111288693 missense probably benign 0.28
R5179:Osbpl8 UTSW 10 111272164 missense probably benign 0.01
R5309:Osbpl8 UTSW 10 111270557 missense probably benign 0.00
R5590:Osbpl8 UTSW 10 111272168 missense probably damaging 0.98
R5783:Osbpl8 UTSW 10 111267783 nonsense probably null
R6293:Osbpl8 UTSW 10 111272238 missense possibly damaging 0.96
R6362:Osbpl8 UTSW 10 111273068 nonsense probably null
R6527:Osbpl8 UTSW 10 111293205 missense probably benign 0.23
R6751:Osbpl8 UTSW 10 111275013 missense possibly damaging 0.67
R6955:Osbpl8 UTSW 10 111269444 critical splice donor site probably null
R7224:Osbpl8 UTSW 10 111275011 missense possibly damaging 0.94
R7235:Osbpl8 UTSW 10 111269427 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGCTGGCCTCATTCATGGTC -3'
(R):5'- ACACTCAGCTCACTTGTACC -3'

Sequencing Primer
(F):5'- CTTGCTTCCCATCTGTCTTTAGGAAG -3'
(R):5'- AGAGCCCTATGCCTGATTTATAGC -3'
Posted On2018-09-12