Incidental Mutation 'R6852:Sacs'
ID535049
Institutional Source Beutler Lab
Gene Symbol Sacs
Ensembl Gene ENSMUSG00000048279
Gene Namesacsin
SynonymsE130115J16Rik
Accession Numbers

Genbank: NM_172809; MGI: 1354724; Ensembl: ENSMUST00000119943

Is this an essential gene? Possibly non essential (E-score: 0.394) question?
Stock #R6852 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location61138457-61240695 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 61179288 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 77 (S77T)
Ref Sequence ENSEMBL: ENSMUSP00000113925 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089394] [ENSMUST00000119509] [ENSMUST00000119943] [ENSMUST00000121091] [ENSMUST00000227570]
Predicted Effect possibly damaging
Transcript: ENSMUST00000089394
AA Change: S80T

PolyPhen 2 Score 0.551 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000086816
Gene: ENSMUSG00000048279
AA Change: S80T

DomainStartEndE-ValueType
SCOP:d1lm8b_ 8 66 3e-3 SMART
Blast:UBQ 9 81 3e-31 BLAST
Blast:HATPase_c 116 211 2e-10 BLAST
low complexity region 608 623 N/A INTRINSIC
low complexity region 664 673 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000119509
AA Change: S80T

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000113007
Gene: ENSMUSG00000048279
AA Change: S80T

DomainStartEndE-ValueType
SCOP:d1lm8b_ 8 66 3e-3 SMART
Blast:UBQ 9 81 3e-31 BLAST
SCOP:d1byqa_ 87 202 5e-3 SMART
Blast:HATPase_c 116 211 2e-10 BLAST
low complexity region 608 623 N/A INTRINSIC
low complexity region 664 673 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119943
AA Change: S80T

PolyPhen 2 Score 0.105 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000113377
Gene: ENSMUSG00000048279
AA Change: S80T

DomainStartEndE-ValueType
internal_repeat_1 61 514 1.35e-52 PROSPERO
low complexity region 608 623 N/A INTRINSIC
low complexity region 664 673 N/A INTRINSIC
low complexity region 1019 1033 N/A INTRINSIC
low complexity region 1131 1145 N/A INTRINSIC
low complexity region 1526 1537 N/A INTRINSIC
low complexity region 2454 2463 N/A INTRINSIC
internal_repeat_1 2475 2934 1.35e-52 PROSPERO
low complexity region 3751 3760 N/A INTRINSIC
low complexity region 3997 4012 N/A INTRINSIC
low complexity region 4285 4300 N/A INTRINSIC
Blast:DnaJ 4304 4363 1e-31 BLAST
PDB:1IUR|A 4309 4376 5e-39 PDB
SCOP:d1gh6a_ 4317 4407 2e-3 SMART
HEPN 4454 4570 9.49e-24 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000121091
AA Change: S77T

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000113925
Gene: ENSMUSG00000048279
AA Change: S77T

DomainStartEndE-ValueType
SCOP:d1lm8b_ 5 63 3e-3 SMART
Blast:UBQ 6 78 4e-31 BLAST
SCOP:d1byqa_ 84 199 4e-3 SMART
Blast:HATPase_c 113 208 2e-10 BLAST
low complexity region 605 620 N/A INTRINSIC
low complexity region 661 670 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000227570
AA Change: S80T

PolyPhen 2 Score 0.271 (Sensitivity: 0.91; Specificity: 0.88)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knockout allele exhibit Purkinje cell degeneration with thickened tortuous dendrites and altered mitochondrial dysfunction. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Gene trapped(3)

Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C T 3: 138,065,169 Q40* probably null Het
1700034E13Rik T C 18: 52,663,633 V81A probably damaging Het
2310035C23Rik T C 1: 105,753,595 L1184P probably damaging Het
5330417C22Rik T C 3: 108,482,338 E203G probably damaging Het
9530053A07Rik T A 7: 28,147,135 I1084N probably damaging Het
A630089N07Rik A G 16: 98,065,655 I369T probably benign Het
Aatk T A 11: 120,010,468 Q977L probably benign Het
Abca4 A T 3: 122,135,195 Q144H probably damaging Het
Ampd3 T C 7: 110,802,546 F416L probably benign Het
Anks1b A G 10: 90,260,654 E425G probably damaging Het
Atm A G 9: 53,482,430 S1737P possibly damaging Het
Bsph1 T A 7: 13,470,330 probably null Het
Cabyr C T 18: 12,754,097 P262S probably benign Het
Cdc14a G A 3: 116,328,676 P214L possibly damaging Het
Cep128 C A 12: 91,366,342 probably null Het
Cfh T A 1: 140,147,749 R250S probably damaging Het
Ddx39 T C 8: 83,723,017 I417T probably benign Het
Dgka T A 10: 128,722,539 K548M probably damaging Het
Efr3a G A 15: 65,829,830 V198I probably benign Het
Epg5 C T 18: 78,012,891 T1760I probably damaging Het
Fat1 T C 8: 45,035,598 V3472A possibly damaging Het
Fbxo48 T A 11: 16,953,402 N9K probably benign Het
Fer1l6 A T 15: 58,594,878 H833L probably damaging Het
Foxn1 G T 11: 78,360,960 Q482K probably benign Het
Fstl5 A G 3: 76,707,855 D741G probably damaging Het
Gm8909 T C 17: 36,168,073 N95D possibly damaging Het
Gmip C T 8: 69,817,991 Q55* probably null Het
Hapln2 G A 3: 88,022,651 T306M possibly damaging Het
Kat6a T A 8: 22,938,660 S1344T probably benign Het
Kctd1 C T 18: 14,986,344 D705N possibly damaging Het
Lhx9 ACC ACCC 1: 138,841,806 probably null Het
Micall2 G T 5: 139,715,793 A482D possibly damaging Het
Mindy3 T A 2: 12,419,252 M1L possibly damaging Het
Mtdh A G 15: 34,136,721 E352G probably damaging Het
Muc5ac G A 7: 141,816,907 V3219I probably benign Het
Myh4 A G 11: 67,252,968 probably null Het
Ncor1 A G 11: 62,343,245 I377T probably damaging Het
Olfr1034 A T 2: 86,046,604 I41F probably benign Het
Oog4 C A 4: 143,439,109 C156F possibly damaging Het
Pcyt1a T C 16: 32,470,120 S260P probably damaging Het
Phf3 A T 1: 30,804,630 F1749L probably damaging Het
Prickle2 T C 6: 92,376,544 D647G probably benign Het
Raver2 T C 4: 101,133,590 S387P probably benign Het
Rgs19 A G 2: 181,689,148 S231P possibly damaging Het
Rpl8 G T 15: 76,905,949 R198L probably benign Het
Samd14 G A 11: 95,021,454 G219D probably damaging Het
Sec16a C T 2: 26,441,419 V195M probably damaging Het
Sesn2 C T 4: 132,493,802 V453I possibly damaging Het
Slc46a3 A T 5: 147,886,160 C291S probably damaging Het
Smarcal1 A G 1: 72,591,173 T129A possibly damaging Het
Sorl1 T A 9: 42,024,398 R1041W possibly damaging Het
Sptlc3 T C 2: 139,566,586 I207T probably benign Het
Srgap3 T C 6: 112,816,661 D118G probably damaging Het
Tas2r117 T A 6: 132,802,929 V10D probably benign Het
Tbcd A G 11: 121,609,380 K1111E probably benign Het
Tor1aip1 A T 1: 156,035,820 L139Q probably damaging Het
Trbv23 T C 6: 41,216,247 V23A probably damaging Het
Ttll3 GGCAAAG GGCAAAGCAAAG 6: 113,399,155 probably null Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,399,157 probably null Het
Ttll3 AAGTA AAGTATAGTA 6: 113,399,159 probably null Het
Vmn1r42 T G 6: 89,844,787 T267P possibly damaging Het
Vmn2r53 C A 7: 12,606,514 V11F probably damaging Het
Vmn2r67 T C 7: 85,152,153 M192V probably damaging Het
Vmn2r78 T C 7: 86,954,603 V663A probably damaging Het
Zdhhc1 C T 8: 105,477,072 G156S possibly damaging Het
Zfp318 GAAGAA GAAGAAAAAGAA 17: 46,412,533 probably benign Het
Zfp318 AAGAAG AAGAAGTAGAAG 17: 46,412,534 probably benign Het
Zfp318 AGAAG AGAAGAGGAAG 17: 46,412,538 probably benign Het
Zfp560 A G 9: 20,348,043 C508R probably damaging Het
Zfp654 G A 16: 64,786,598 L414F probably damaging Het
Zfp872 A T 9: 22,200,059 Y278F probably damaging Het
Zscan20 T C 4: 128,589,722 S385G probably damaging Het
Other mutations in Sacs
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01540:Sacs APN 14 61191635 missense possibly damaging 0.64
IGL01839:Sacs APN 14 61183945 intron probably benign
IGL02024:Sacs APN 14 61189678 missense probably damaging 0.96
IGL02247:Sacs APN 14 61192535 missense probably damaging 1.00
F6893:Sacs UTSW 14 61212976 missense probably benign
IGL03052:Sacs UTSW 14 61207858 missense probably damaging 0.99
R0090:Sacs UTSW 14 61205440 missense probably damaging 1.00
R0102:Sacs UTSW 14 61204568 missense probably damaging 1.00
R0102:Sacs UTSW 14 61204568 missense probably damaging 1.00
R0390:Sacs UTSW 14 61205640 missense possibly damaging 0.92
R0479:Sacs UTSW 14 61191479 missense probably damaging 0.99
R0556:Sacs UTSW 14 61183958 missense probably damaging 0.99
R0673:Sacs UTSW 14 61210215 missense possibly damaging 0.89
R0748:Sacs UTSW 14 61209265 missense probably damaging 0.99
R0931:Sacs UTSW 14 61203495 missense probably benign
R0972:Sacs UTSW 14 61211963 nonsense probably null
R1281:Sacs UTSW 14 61191801 missense probably benign 0.02
R1340:Sacs UTSW 14 61204509 missense probably damaging 0.98
R1351:Sacs UTSW 14 61202761 missense probably benign 0.00
R1499:Sacs UTSW 14 61213704 missense possibly damaging 0.70
R1538:Sacs UTSW 14 61210059 missense probably damaging 0.98
R1581:Sacs UTSW 14 61213679 missense probably damaging 0.96
R1599:Sacs UTSW 14 61203638 missense probably benign
R1631:Sacs UTSW 14 61210732 nonsense probably null
R1635:Sacs UTSW 14 61203828 missense probably damaging 0.98
R1655:Sacs UTSW 14 61191782 missense probably benign
R1660:Sacs UTSW 14 61209009 missense probably damaging 0.99
R1707:Sacs UTSW 14 61209762 missense probably benign 0.01
R1733:Sacs UTSW 14 61205454 missense probably damaging 1.00
R1772:Sacs UTSW 14 61210897 missense probably damaging 1.00
R1976:Sacs UTSW 14 61202895 missense probably benign
R2055:Sacs UTSW 14 61214049 missense probably damaging 0.97
R2083:Sacs UTSW 14 61206506 missense possibly damaging 0.69
R2091:Sacs UTSW 14 61191919 missense possibly damaging 0.95
R2105:Sacs UTSW 14 61173441 missense possibly damaging 0.90
R2109:Sacs UTSW 14 61173453 splice site probably null
R2117:Sacs UTSW 14 61213771 missense probably benign 0.01
R2122:Sacs UTSW 14 61212316 missense probably damaging 1.00
R2148:Sacs UTSW 14 61173378 missense probably damaging 0.97
R2151:Sacs UTSW 14 61209640 missense probably damaging 1.00
R2231:Sacs UTSW 14 61205929 unclassified probably null
R2248:Sacs UTSW 14 61212802 missense probably damaging 1.00
R2271:Sacs UTSW 14 61204660 missense probably benign 0.06
R2314:Sacs UTSW 14 61207759 missense probably benign 0.17
R2436:Sacs UTSW 14 61202905 missense possibly damaging 0.94
R2445:Sacs UTSW 14 61205206 missense probably damaging 1.00
R2512:Sacs UTSW 14 61203080 missense probably benign 0.00
R3434:Sacs UTSW 14 61212303 missense probably damaging 1.00
R3785:Sacs UTSW 14 61183961 missense probably damaging 1.00
R3786:Sacs UTSW 14 61183961 missense probably damaging 1.00
R3796:Sacs UTSW 14 61206121 missense possibly damaging 0.87
R3798:Sacs UTSW 14 61206121 missense possibly damaging 0.87
R3872:Sacs UTSW 14 61148068 missense probably benign 0.30
R3873:Sacs UTSW 14 61192286 missense possibly damaging 0.64
R3892:Sacs UTSW 14 61204387 missense probably damaging 0.98
R4184:Sacs UTSW 14 61213944 missense probably damaging 0.97
R4204:Sacs UTSW 14 61173443 missense possibly damaging 0.93
R4249:Sacs UTSW 14 61203457 missense probably benign 0.02
R4256:Sacs UTSW 14 61206337 missense probably damaging 1.00
R4370:Sacs UTSW 14 61212309 missense probably damaging 1.00
R4445:Sacs UTSW 14 61204686 missense probably benign 0.30
R4503:Sacs UTSW 14 61207603 missense probably damaging 1.00
R4548:Sacs UTSW 14 61191938 missense probably damaging 1.00
R4582:Sacs UTSW 14 61191698 missense probably damaging 1.00
R4613:Sacs UTSW 14 61211797 intron probably null
R4639:Sacs UTSW 14 61207268 missense probably benign 0.12
R4697:Sacs UTSW 14 61212747 missense probably benign 0.19
R4706:Sacs UTSW 14 61204273 missense probably damaging 1.00
R4717:Sacs UTSW 14 61212855 missense probably damaging 1.00
R4777:Sacs UTSW 14 61211809 missense probably damaging 1.00
R4888:Sacs UTSW 14 61212198 missense probably damaging 1.00
R4913:Sacs UTSW 14 61213797 missense probably benign 0.17
R4973:Sacs UTSW 14 61213122 missense probably damaging 1.00
R4986:Sacs UTSW 14 61213043 nonsense probably null
R5090:Sacs UTSW 14 61205253 missense probably damaging 1.00
R5243:Sacs UTSW 14 61205957 nonsense probably null
R5292:Sacs UTSW 14 61211983 missense probably damaging 1.00
R5308:Sacs UTSW 14 61192400 missense probably benign 0.21
R5337:Sacs UTSW 14 61193514 intron probably benign
R5502:Sacs UTSW 14 61206100 missense probably damaging 1.00
R5586:Sacs UTSW 14 61206441 nonsense probably null
R5692:Sacs UTSW 14 61207839 missense probably benign 0.00
R5725:Sacs UTSW 14 61211110 missense probably damaging 1.00
R5854:Sacs UTSW 14 61211547 missense probably damaging 1.00
R5959:Sacs UTSW 14 61212400 missense probably damaging 0.99
R5960:Sacs UTSW 14 61208695 missense probably benign 0.30
R5968:Sacs UTSW 14 61189629 missense probably damaging 0.99
R5983:Sacs UTSW 14 61205199 missense probably damaging 1.00
R5992:Sacs UTSW 14 61205543 missense probably damaging 1.00
R6076:Sacs UTSW 14 61204536 nonsense probably null
R6175:Sacs UTSW 14 61212826 missense possibly damaging 0.82
R6347:Sacs UTSW 14 61211160 missense probably damaging 1.00
R6357:Sacs UTSW 14 61208824 missense possibly damaging 0.47
R6415:Sacs UTSW 14 61205359 missense probably damaging 1.00
R6469:Sacs UTSW 14 61191248 missense probably damaging 1.00
R6503:Sacs UTSW 14 61211361 missense probably benign 0.00
R6523:Sacs UTSW 14 61202961 missense probably damaging 0.99
R6615:Sacs UTSW 14 61208934 missense probably benign 0.15
R6729:Sacs UTSW 14 61210518 missense probably damaging 1.00
R6731:Sacs UTSW 14 61180700 intron probably null
R6797:Sacs UTSW 14 61213073 missense probably damaging 1.00
R6922:Sacs UTSW 14 61211425 missense probably damaging 1.00
X0067:Sacs UTSW 14 61208019 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGGGTCAGCGGTGAGTTAA -3'
(R):5'- GTCTGGCCTCAAAAGATCCTCC -3'

Sequencing Primer
(F):5'- CATCAGATCGGCTCCTGATGTG -3'
(R):5'- GCCTCCTATGTACTGAGATTACAAGC -3'
Posted On2018-09-12