Incidental Mutation 'R6853:Msh3'
ID535106
Institutional Source Beutler Lab
Gene Symbol Msh3
Ensembl Gene ENSMUSG00000014850
Gene NamemutS homolog 3
SynonymsRep3, Rep-3, D13Em1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.286) question?
Stock #R6853 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location92211872-92355003 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 92312572 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000140002 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022220] [ENSMUST00000185852] [ENSMUST00000187874] [ENSMUST00000191509] [ENSMUST00000191550]
Predicted Effect probably null
Transcript: ENSMUST00000022220
SMART Domains Protein: ENSMUSP00000022220
Gene: ENSMUSG00000014850

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
low complexity region 24 40 N/A INTRINSIC
Pfam:MutS_I 188 301 1.6e-35 PFAM
Pfam:MutS_II 324 481 2.2e-36 PFAM
MUTSd 513 828 7.62e-97 SMART
MUTSac 847 1049 9.7e-122 SMART
Predicted Effect probably null
Transcript: ENSMUST00000185852
SMART Domains Protein: ENSMUSP00000140002
Gene: ENSMUSG00000014850

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
low complexity region 24 40 N/A INTRINSIC
Pfam:MutS_I 188 301 7.2e-35 PFAM
Pfam:MutS_II 324 481 2.2e-36 PFAM
MUTSd 513 828 7.62e-97 SMART
MUTSac 847 1049 9.7e-122 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000187874
SMART Domains Protein: ENSMUSP00000139620
Gene: ENSMUSG00000014850

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
low complexity region 24 40 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000191509
SMART Domains Protein: ENSMUSP00000141158
Gene: ENSMUSG00000014850

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
low complexity region 24 40 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000191550
SMART Domains Protein: ENSMUSP00000140659
Gene: ENSMUSG00000014850

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
low complexity region 24 40 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene forms a heterodimer with MSH2 to form MutS beta, part of the post-replicative DNA mismatch repair system. MutS beta initiates mismatch repair by binding to a mismatch and then forming a complex with MutL alpha heterodimer. This gene contains a polymorphic 9 bp tandem repeat sequence in the first exon. The repeat is present 6 times in the reference genome sequence and 3-7 repeats have been reported. Defects in this gene are a cause of susceptibility to endometrial cancer. [provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a partial defect mismatch repair and development of intestinal tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030458C11Rik G T 15: 12,817,945 D138E probably benign Het
Atp13a5 A G 16: 29,321,662 S359P possibly damaging Het
Bcam T C 7: 19,760,406 D355G probably damaging Het
Bmp8a C A 4: 123,342,683 W9L unknown Het
Cacul1 A T 19: 60,529,466 Y334* probably null Het
Ccdc178 A T 18: 22,109,876 N227K probably benign Het
Ceacam2 T C 7: 25,518,136 N318S possibly damaging Het
Cntrl T A 2: 35,129,821 S553R possibly damaging Het
Ctsa T A 2: 164,837,364 M331K probably benign Het
Cyp2c38 T A 19: 39,438,304 Q184H probably benign Het
Cyp2c70 C T 19: 40,183,920 E93K possibly damaging Het
D430041D05Rik C T 2: 104,241,155 V1267M probably damaging Het
Ddias C T 7: 92,859,565 A381T possibly damaging Het
Dnhd1 G A 7: 105,703,728 C2696Y probably benign Het
Efr3a G A 15: 65,829,830 V198I probably benign Het
Farp2 T C 1: 93,570,016 F256S probably damaging Het
Fga A G 3: 83,030,912 Y198C probably damaging Het
Gabpa T A 16: 84,860,499 C421S probably damaging Het
Gm21798 A T 15: 64,817,865 probably benign Het
Gm21798 A T 15: 64,817,867 probably benign Het
Gm7145 A C 1: 117,986,144 N252T possibly damaging Het
H2-Q6 T C 17: 35,428,359 *327R probably null Het
H6pd T C 4: 149,982,462 D489G probably benign Het
Htra2 A G 6: 83,053,831 probably benign Het
Ice1 T G 13: 70,603,302 E1555A possibly damaging Het
Inpp5d T A 1: 87,681,680 probably null Het
Itih2 T C 2: 10,115,266 D320G probably damaging Het
Kif1a T G 1: 93,039,802 H1129P possibly damaging Het
Kmt2a G A 9: 44,818,407 probably benign Het
L3mbtl4 G A 17: 68,777,920 D609N probably damaging Het
Lgals9 A T 11: 78,966,006 D248E probably benign Het
Lhx9 ACC ACCC 1: 138,841,806 probably null Het
Mtus2 A G 5: 148,107,011 K803R probably damaging Het
Oas1a T A 5: 120,907,428 I17L possibly damaging Het
Olfr1480 T A 19: 13,529,931 I130K possibly damaging Het
Olfr178 C T 16: 58,889,758 S154N possibly damaging Het
Olfr178 T A 16: 58,889,759 S154C probably damaging Het
Olfr851 T G 9: 19,496,806 Y19* probably null Het
Olfr92 G A 17: 37,111,508 T158I probably benign Het
Otof T C 5: 30,388,239 D539G probably damaging Het
Pabpc4 T C 4: 123,294,743 Y382H possibly damaging Het
Rag1 T C 2: 101,642,221 T859A probably damaging Het
Ralbp1 C T 17: 65,852,756 R504H possibly damaging Het
Sdk2 A G 11: 113,780,929 F2131S probably damaging Het
Sik1 A T 17: 31,854,206 probably null Het
Sis A G 3: 72,891,426 I1763T possibly damaging Het
Slc39a6 A G 18: 24,599,319 I304T possibly damaging Het
Slc5a12 A G 2: 110,624,194 S367G probably benign Het
Smchd1 A T 17: 71,436,743 W476R probably damaging Het
Spag17 T C 3: 100,013,235 Y429H possibly damaging Het
Stt3a G A 9: 36,741,727 S553F possibly damaging Het
Sult2a1 C T 7: 13,801,487 V214I possibly damaging Het
Supt6 T C 11: 78,232,830 E38G possibly damaging Het
Tenm4 G A 7: 96,837,295 G990R possibly damaging Het
Thop1 T C 10: 81,075,661 probably null Het
Thumpd2 C A 17: 81,065,030 D11Y possibly damaging Het
Tmf1 T G 6: 97,168,849 I574L probably damaging Het
Tnfaip3 A G 10: 19,003,751 V623A probably benign Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,399,157 probably null Het
Ush2a T G 1: 188,911,237 Y4265* probably null Het
Vamp5 G A 6: 72,380,441 probably benign Het
Vmn2r12 A T 5: 109,092,905 L114Q probably damaging Het
Vmn2r98 A T 17: 19,065,801 Y187F probably benign Het
Other mutations in Msh3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00895:Msh3 APN 13 92344964 missense probably damaging 1.00
IGL00983:Msh3 APN 13 92300277 missense probably damaging 1.00
IGL01490:Msh3 APN 13 92300305 missense probably damaging 1.00
IGL02072:Msh3 APN 13 92300295 missense probably damaging 1.00
IGL02313:Msh3 APN 13 92349312 missense possibly damaging 0.86
IGL02711:Msh3 APN 13 92351311 missense probably damaging 1.00
IGL03108:Msh3 APN 13 92221088 splice site probably benign
IGL03227:Msh3 APN 13 92285960 missense probably damaging 0.98
R0164:Msh3 UTSW 13 92349209 missense probably damaging 1.00
R0164:Msh3 UTSW 13 92349209 missense probably damaging 1.00
R0415:Msh3 UTSW 13 92346786 missense possibly damaging 0.89
R0457:Msh3 UTSW 13 92220997 missense probably damaging 1.00
R0659:Msh3 UTSW 13 92345096 missense possibly damaging 0.80
R0661:Msh3 UTSW 13 92345096 missense possibly damaging 0.80
R0686:Msh3 UTSW 13 92351431 missense possibly damaging 0.53
R0688:Msh3 UTSW 13 92351431 missense possibly damaging 0.53
R0707:Msh3 UTSW 13 92347340 nonsense probably null
R1605:Msh3 UTSW 13 92300275 missense probably null 1.00
R1622:Msh3 UTSW 13 92344954 critical splice donor site probably null
R1771:Msh3 UTSW 13 92212496 missense probably benign 0.05
R1970:Msh3 UTSW 13 92249820 splice site probably benign
R1971:Msh3 UTSW 13 92223276 missense probably damaging 1.00
R1971:Msh3 UTSW 13 92249820 splice site probably benign
R2894:Msh3 UTSW 13 92342360 missense probably benign 0.16
R3837:Msh3 UTSW 13 92354858 missense probably damaging 1.00
R4119:Msh3 UTSW 13 92354011 intron probably benign
R4225:Msh3 UTSW 13 92285923 missense probably benign 0.03
R4881:Msh3 UTSW 13 92266041 intron probably benign
R5118:Msh3 UTSW 13 92309434 splice site probably benign
R5209:Msh3 UTSW 13 92344954 critical splice donor site probably null
R5817:Msh3 UTSW 13 92286000 missense possibly damaging 0.86
R5849:Msh3 UTSW 13 92249878 missense possibly damaging 0.81
R5851:Msh3 UTSW 13 92215522 missense probably benign 0.00
R5940:Msh3 UTSW 13 92249843 missense probably damaging 1.00
R6004:Msh3 UTSW 13 92342414 critical splice acceptor site probably null
R6363:Msh3 UTSW 13 92212524 missense probably damaging 1.00
R6510:Msh3 UTSW 13 92353264 nonsense probably null
R6654:Msh3 UTSW 13 92345042 missense probably benign 0.01
R7022:Msh3 UTSW 13 92235588 missense probably damaging 1.00
R7098:Msh3 UTSW 13 92274111 missense possibly damaging 0.95
R7103:Msh3 UTSW 13 92274800 missense probably benign
R7148:Msh3 UTSW 13 92354822 missense probably benign 0.18
R7171:Msh3 UTSW 13 92349298 missense probably benign 0.00
R7317:Msh3 UTSW 13 92286004 missense probably damaging 1.00
R7369:Msh3 UTSW 13 92299262 missense probably benign 0.15
S24628:Msh3 UTSW 13 92346786 missense possibly damaging 0.89
X0027:Msh3 UTSW 13 92274070 missense probably damaging 0.98
X0063:Msh3 UTSW 13 92274785 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCATGCTGCTGGTGTTCTCT -3'
(R):5'- TGTTGTTATTCAAGGCTGACATCT -3'

Sequencing Primer
(F):5'- CTTCTGAGCACTGGGTGAACAG -3'
(R):5'- GGATGACAGGATTCGAGT -3'
Posted On2018-09-12