Incidental Mutation 'R6854:Palmd'
ID535137
Institutional Source Beutler Lab
Gene Symbol Palmd
Ensembl Gene ENSMUSG00000033377
Gene Namepalmdelphin
Synonyms4631423C22Rik, PALML
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R6854 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location116918258-116968987 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 116923463 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 462 (S462P)
Ref Sequence ENSEMBL: ENSMUSP00000044693 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040097] [ENSMUST00000119557] [ENSMUST00000143611]
Predicted Effect probably benign
Transcript: ENSMUST00000040097
AA Change: S462P

PolyPhen 2 Score 0.065 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000044693
Gene: ENSMUSG00000033377
AA Change: S462P

DomainStartEndE-ValueType
low complexity region 29 44 N/A INTRINSIC
Pfam:Paralemmin 65 512 3.6e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119557
AA Change: S462P

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000113107
Gene: ENSMUSG00000033377
AA Change: S462P

DomainStartEndE-ValueType
low complexity region 29 44 N/A INTRINSIC
Pfam:Paralemmin 64 278 6.6e-14 PFAM
Pfam:Paralemmin 323 515 1.3e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143611
SMART Domains Protein: ENSMUSP00000122725
Gene: ENSMUSG00000033377

DomainStartEndE-ValueType
coiled coil region 4 94 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (44/44)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak T C 19: 9,015,235 S4628P probably damaging Het
Aspm G A 1: 139,463,182 R735H possibly damaging Het
Atp4a T C 7: 30,715,008 V152A probably benign Het
BC035947 G A 1: 78,498,488 T469I probably damaging Het
Bicra A T 7: 15,988,762 S277T probably benign Het
Catsperg1 A T 7: 29,181,702 N1142K possibly damaging Het
Ccnd3 T C 17: 47,578,720 probably benign Het
Cdc25a A G 9: 109,879,927 K79E probably damaging Het
Cfap44 A G 16: 44,449,028 probably null Het
Chd5 C A 4: 152,382,938 N1644K probably damaging Het
Flrt3 C T 2: 140,660,718 R330H probably damaging Het
Gm6034 T A 17: 36,057,218 probably null Het
Hivep1 A G 13: 42,156,507 E741G probably damaging Het
Iqgap3 T C 3: 88,096,951 V448A probably damaging Het
Itsn2 A G 12: 4,652,382 R679G probably benign Het
Klrb1c A G 6: 128,788,418 S70P possibly damaging Het
Maml2 C T 9: 13,705,835 T159I possibly damaging Het
Mroh2a G A 1: 88,243,950 R770Q probably damaging Het
Mycl G A 4: 123,000,246 D280N probably damaging Het
Nlrp1b G A 11: 71,228,433 T12I possibly damaging Het
Olfr1315-ps1 T C 2: 112,110,647 N202D probably benign Het
Olfr187 A C 16: 59,036,065 I224S possibly damaging Het
Phyhd1 A C 2: 30,269,761 I36L possibly damaging Het
Plcd1 T C 9: 119,074,321 probably null Het
Pml G C 9: 58,219,906 A806G probably damaging Het
Ppp6r1 C A 7: 4,632,396 A838S probably benign Het
Pqlc3 G A 12: 16,999,829 L43F probably damaging Het
Prkdc C T 16: 15,651,538 T169I probably damaging Het
Prr23a1 G T 9: 98,842,935 V117L possibly damaging Het
Pus7 T C 5: 23,768,847 silent Het
Rdh7 T C 10: 127,888,381 E78G probably benign Het
Repin1 G T 6: 48,593,891 probably benign Het
Rptn A G 3: 93,398,123 N921S possibly damaging Het
Sema4f A G 6: 82,918,002 L404P probably damaging Het
Serinc4 T A 2: 121,456,550 M2L probably benign Het
Siglecf T C 7: 43,352,180 V138A probably benign Het
Speer2 T A 16: 69,858,887 Q106L probably damaging Het
Sptb G A 12: 76,603,480 P1821L probably damaging Het
St3gal3 C A 4: 117,958,530 M107I probably benign Het
Tmem25 T C 9: 44,796,008 K265E possibly damaging Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,399,157 probably null Het
Vsig10 G A 5: 117,338,407 V309I probably benign Het
Zfp318 G GAAGAAA 17: 46,412,542 probably benign Het
Other mutations in Palmd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00703:Palmd APN 3 116927391 splice site probably benign
IGL01112:Palmd APN 3 116924273 missense probably damaging 1.00
IGL01484:Palmd APN 3 116953145 splice site probably benign
IGL01527:Palmd APN 3 116927188 nonsense probably null
IGL01561:Palmd APN 3 116924093 missense probably damaging 0.99
IGL01975:Palmd APN 3 116923634 missense probably benign 0.24
R0107:Palmd UTSW 3 116924076 missense probably damaging 1.00
R1099:Palmd UTSW 3 116923225 missense possibly damaging 0.71
R1552:Palmd UTSW 3 116948040 splice site probably benign
R1613:Palmd UTSW 3 116923504 missense probably damaging 1.00
R1710:Palmd UTSW 3 116923657 missense probably damaging 1.00
R2090:Palmd UTSW 3 116927434 missense probably damaging 1.00
R2869:Palmd UTSW 3 116923751 missense possibly damaging 0.60
R2869:Palmd UTSW 3 116923751 missense possibly damaging 0.60
R2870:Palmd UTSW 3 116923751 missense possibly damaging 0.60
R2870:Palmd UTSW 3 116923751 missense possibly damaging 0.60
R2871:Palmd UTSW 3 116923751 missense possibly damaging 0.60
R2871:Palmd UTSW 3 116923751 missense possibly damaging 0.60
R2872:Palmd UTSW 3 116923751 missense possibly damaging 0.60
R2872:Palmd UTSW 3 116923751 missense possibly damaging 0.60
R2873:Palmd UTSW 3 116923751 missense possibly damaging 0.60
R3774:Palmd UTSW 3 116927663 missense probably damaging 1.00
R3981:Palmd UTSW 3 116923823 missense probably benign 0.01
R3982:Palmd UTSW 3 116923823 missense probably benign 0.01
R3983:Palmd UTSW 3 116923823 missense probably benign 0.01
R4955:Palmd UTSW 3 116924224 missense probably damaging 1.00
R5103:Palmd UTSW 3 116927421 missense probably damaging 1.00
R5261:Palmd UTSW 3 116923360 missense probably benign 0.04
R5265:Palmd UTSW 3 116923849 missense possibly damaging 0.67
R5292:Palmd UTSW 3 116923744 missense probably benign 0.00
R5499:Palmd UTSW 3 116923832 missense probably benign 0.01
R5597:Palmd UTSW 3 116923576 missense probably damaging 1.00
R5666:Palmd UTSW 3 116924101 missense possibly damaging 0.55
R5817:Palmd UTSW 3 116918623 missense probably benign 0.01
R6843:Palmd UTSW 3 116924215 missense probably damaging 1.00
R7052:Palmd UTSW 3 116923363 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- TAGTAAACAGCAGCGGCATG -3'
(R):5'- CTGCCTTCTGATGTGGATGAC -3'

Sequencing Primer
(F):5'- AAGGATCCTCAGTCCCGTC -3'
(R):5'- TGGATGACACAGAACCTGTAAC -3'
Posted On2018-09-12