Incidental Mutation 'R6854:Catsperg1'
ID535148
Institutional Source Beutler Lab
Gene Symbol Catsperg1
Ensembl Gene ENSMUSG00000049676
Gene Namecation channel sperm associated auxiliary subunit gamma 1
SynonymsA230107C01Rik, Catsperg
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.141) question?
Stock #R6854 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location29181321-29214035 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 29181702 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 1142 (N1142K)
Ref Sequence ENSEMBL: ENSMUSP00000129837 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047846] [ENSMUST00000059642] [ENSMUST00000163782] [ENSMUST00000164653] [ENSMUST00000169143] [ENSMUST00000182328] [ENSMUST00000186182] [ENSMUST00000209034]
Predicted Effect probably benign
Transcript: ENSMUST00000047846
AA Change: N1089K

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000045233
Gene: ENSMUSG00000049676
AA Change: N1089K

DomainStartEndE-ValueType
Pfam:CATSPERG 1 920 N/A PFAM
transmembrane domain 1012 1034 N/A INTRINSIC
low complexity region 1058 1073 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000059642
SMART Domains Protein: ENSMUSP00000051657
Gene: ENSMUSG00000030591

DomainStartEndE-ValueType
low complexity region 11 23 N/A INTRINSIC
low complexity region 60 82 N/A INTRINSIC
low complexity region 117 129 N/A INTRINSIC
Pfam:CSN8_PSD8_EIF3K 189 330 1.2e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163782
SMART Domains Protein: ENSMUSP00000127409
Gene: ENSMUSG00000049676

DomainStartEndE-ValueType
Pfam:CATSPERG 1 93 1.7e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164653
SMART Domains Protein: ENSMUSP00000131827
Gene: ENSMUSG00000049676

DomainStartEndE-ValueType
Pfam:CATSPERG 1 111 1.4e-44 PFAM
Pfam:CATSPERG 108 334 8.5e-93 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000169143
AA Change: N1142K

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000129837
Gene: ENSMUSG00000049676
AA Change: N1142K

DomainStartEndE-ValueType
Pfam:CATSPERG 2 973 N/A PFAM
transmembrane domain 1065 1087 N/A INTRINSIC
low complexity region 1111 1126 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182328
SMART Domains Protein: ENSMUSP00000138613
Gene: ENSMUSG00000030591

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
Pfam:SAC3_GANP 49 232 1.2e-37 PFAM
Pfam:PCI_Csn8 125 266 4.1e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000186182
SMART Domains Protein: ENSMUSP00000139514
Gene: ENSMUSG00000030591

DomainStartEndE-ValueType
low complexity region 11 23 N/A INTRINSIC
low complexity region 60 82 N/A INTRINSIC
Pfam:SAC3_GANP 113 296 1.3e-37 PFAM
Pfam:PCI_Csn8 189 330 2.3e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209034
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (44/44)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak T C 19: 9,015,235 S4628P probably damaging Het
Aspm G A 1: 139,463,182 R735H possibly damaging Het
Atp4a T C 7: 30,715,008 V152A probably benign Het
BC035947 G A 1: 78,498,488 T469I probably damaging Het
Bicra A T 7: 15,988,762 S277T probably benign Het
Ccnd3 T C 17: 47,578,720 probably benign Het
Cdc25a A G 9: 109,879,927 K79E probably damaging Het
Cfap44 A G 16: 44,449,028 probably null Het
Chd5 C A 4: 152,382,938 N1644K probably damaging Het
Flrt3 C T 2: 140,660,718 R330H probably damaging Het
Gm6034 T A 17: 36,057,218 probably null Het
Hivep1 A G 13: 42,156,507 E741G probably damaging Het
Iqgap3 T C 3: 88,096,951 V448A probably damaging Het
Itsn2 A G 12: 4,652,382 R679G probably benign Het
Klrb1c A G 6: 128,788,418 S70P possibly damaging Het
Maml2 C T 9: 13,705,835 T159I possibly damaging Het
Mroh2a G A 1: 88,243,950 R770Q probably damaging Het
Mycl G A 4: 123,000,246 D280N probably damaging Het
Nlrp1b G A 11: 71,228,433 T12I possibly damaging Het
Olfr1315-ps1 T C 2: 112,110,647 N202D probably benign Het
Olfr187 A C 16: 59,036,065 I224S possibly damaging Het
Palmd A G 3: 116,923,463 S462P probably benign Het
Phyhd1 A C 2: 30,269,761 I36L possibly damaging Het
Plcd1 T C 9: 119,074,321 probably null Het
Pml G C 9: 58,219,906 A806G probably damaging Het
Ppp6r1 C A 7: 4,632,396 A838S probably benign Het
Pqlc3 G A 12: 16,999,829 L43F probably damaging Het
Prkdc C T 16: 15,651,538 T169I probably damaging Het
Prr23a1 G T 9: 98,842,935 V117L possibly damaging Het
Pus7 T C 5: 23,768,847 silent Het
Rdh7 T C 10: 127,888,381 E78G probably benign Het
Repin1 G T 6: 48,593,891 probably benign Het
Rptn A G 3: 93,398,123 N921S possibly damaging Het
Sema4f A G 6: 82,918,002 L404P probably damaging Het
Serinc4 T A 2: 121,456,550 M2L probably benign Het
Siglecf T C 7: 43,352,180 V138A probably benign Het
Speer2 T A 16: 69,858,887 Q106L probably damaging Het
Sptb G A 12: 76,603,480 P1821L probably damaging Het
St3gal3 C A 4: 117,958,530 M107I probably benign Het
Tmem25 T C 9: 44,796,008 K265E possibly damaging Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,399,157 probably null Het
Vsig10 G A 5: 117,338,407 V309I probably benign Het
Zfp318 G GAAGAAA 17: 46,412,542 probably benign Het
Other mutations in Catsperg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00808:Catsperg1 APN 7 29198146 missense probably damaging 1.00
IGL01693:Catsperg1 APN 7 29185098 unclassified probably benign
IGL01935:Catsperg1 APN 7 29195871 unclassified probably null
IGL02484:Catsperg1 APN 7 29210920 start gained probably benign
IGL02584:Catsperg1 APN 7 29184721 missense probably damaging 1.00
IGL02880:Catsperg1 APN 7 29195485 missense possibly damaging 0.75
IGL03268:Catsperg1 APN 7 29200243 missense probably damaging 1.00
IGL03285:Catsperg1 APN 7 29198172 missense possibly damaging 0.89
solid UTSW 7 29190298 nonsense probably null
K7894:Catsperg1 UTSW 7 29197154 intron probably benign
R0180:Catsperg1 UTSW 7 29190431 splice site probably null
R0344:Catsperg1 UTSW 7 29195540 missense probably damaging 1.00
R0523:Catsperg1 UTSW 7 29185190 unclassified probably benign
R0561:Catsperg1 UTSW 7 29182312 missense probably damaging 1.00
R0610:Catsperg1 UTSW 7 29190619 missense probably damaging 1.00
R0762:Catsperg1 UTSW 7 29189952 missense probably benign 0.03
R1074:Catsperg1 UTSW 7 29206849 missense probably damaging 1.00
R1201:Catsperg1 UTSW 7 29191670 missense possibly damaging 0.77
R1346:Catsperg1 UTSW 7 29182334 splice site probably null
R1387:Catsperg1 UTSW 7 29206864 missense probably damaging 1.00
R1467:Catsperg1 UTSW 7 29185008 missense probably damaging 1.00
R1467:Catsperg1 UTSW 7 29185008 missense probably damaging 1.00
R1486:Catsperg1 UTSW 7 29185495 missense probably damaging 1.00
R1883:Catsperg1 UTSW 7 29182236 critical splice donor site probably null
R1932:Catsperg1 UTSW 7 29198143 missense probably damaging 1.00
R1942:Catsperg1 UTSW 7 29206807 missense possibly damaging 0.89
R2127:Catsperg1 UTSW 7 29185040 missense probably damaging 1.00
R2205:Catsperg1 UTSW 7 29185246 nonsense probably null
R4214:Catsperg1 UTSW 7 29195932 missense possibly damaging 0.80
R4678:Catsperg1 UTSW 7 29190296 missense probably benign 0.13
R5008:Catsperg1 UTSW 7 29195434 nonsense probably null
R5217:Catsperg1 UTSW 7 29190298 nonsense probably null
R5268:Catsperg1 UTSW 7 29195247 missense probably benign 0.41
R5372:Catsperg1 UTSW 7 29210712 missense probably benign 0.08
R5393:Catsperg1 UTSW 7 29185499 missense probably damaging 1.00
R5406:Catsperg1 UTSW 7 29185523 missense probably damaging 1.00
R5557:Catsperg1 UTSW 7 29195871 missense possibly damaging 0.89
R5921:Catsperg1 UTSW 7 29190523 missense possibly damaging 0.78
R5928:Catsperg1 UTSW 7 29206615 missense probably damaging 0.99
R5960:Catsperg1 UTSW 7 29184783 unclassified probably benign
R6053:Catsperg1 UTSW 7 29210814 nonsense probably null
R6144:Catsperg1 UTSW 7 29210695 missense probably damaging 0.99
R6215:Catsperg1 UTSW 7 29200239 missense probably damaging 1.00
R6334:Catsperg1 UTSW 7 29206357 missense probably benign 0.01
R6446:Catsperg1 UTSW 7 29206567 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGAGGACTCGGGACTGATTC -3'
(R):5'- ACCAGCTTCTTTATAGCCCTGG -3'

Sequencing Primer
(F):5'- ACTCGGGACTGATTCTGCAAG -3'
(R):5'- ATCCTGTTCTGCCTCGTGTGG -3'
Posted On2018-09-12