Incidental Mutation 'R6855:Sgip1'
ID535188
Institutional Source Beutler Lab
Gene Symbol Sgip1
Ensembl Gene ENSMUSG00000028524
Gene NameSH3-domain GRB2-like (endophilin) interacting protein 1
Synonyms3110007P09Rik
Accession Numbers

Genbank: NM_144906; MGI: 1920344

Is this an essential gene? Probably non essential (E-score: 0.149) question?
Stock #R6855 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location102741297-102973628 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 102962376 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 560 (C560R)
Ref Sequence ENSEMBL: ENSMUSP00000079553 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066824] [ENSMUST00000072481] [ENSMUST00000080728] [ENSMUST00000106882]
Predicted Effect probably benign
Transcript: ENSMUST00000066824
AA Change: C413R

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000063712
Gene: ENSMUSG00000028524
AA Change: C413R

DomainStartEndE-ValueType
low complexity region 51 62 N/A INTRINSIC
low complexity region 102 112 N/A INTRINSIC
low complexity region 148 160 N/A INTRINSIC
low complexity region 241 262 N/A INTRINSIC
low complexity region 281 308 N/A INTRINSIC
low complexity region 313 330 N/A INTRINSIC
low complexity region 332 353 N/A INTRINSIC
Pfam:muHD 391 658 5.9e-79 PFAM
Pfam:Adap_comp_sub 469 650 1.9e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000072481
AA Change: C393R

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000072301
Gene: ENSMUSG00000028524
AA Change: C393R

DomainStartEndE-ValueType
low complexity region 51 62 N/A INTRINSIC
low complexity region 102 112 N/A INTRINSIC
low complexity region 148 160 N/A INTRINSIC
low complexity region 241 262 N/A INTRINSIC
low complexity region 281 308 N/A INTRINSIC
low complexity region 313 330 N/A INTRINSIC
low complexity region 332 353 N/A INTRINSIC
Pfam:muHD 371 638 5.5e-79 PFAM
Pfam:Adap_comp_sub 449 630 1.8e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000080728
AA Change: C560R

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000079553
Gene: ENSMUSG00000028524
AA Change: C560R

DomainStartEndE-ValueType
low complexity region 52 63 N/A INTRINSIC
low complexity region 103 113 N/A INTRINSIC
low complexity region 149 161 N/A INTRINSIC
low complexity region 242 263 N/A INTRINSIC
low complexity region 335 366 N/A INTRINSIC
low complexity region 423 443 N/A INTRINSIC
low complexity region 448 475 N/A INTRINSIC
low complexity region 480 497 N/A INTRINSIC
low complexity region 499 520 N/A INTRINSIC
Pfam:muHD 538 805 9e-79 PFAM
Pfam:Adap_comp_sub 617 797 2.7e-9 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000106882
AA Change: C580R

PolyPhen 2 Score 0.863 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000102495
Gene: ENSMUSG00000028524
AA Change: C580R

DomainStartEndE-ValueType
low complexity region 52 63 N/A INTRINSIC
low complexity region 103 113 N/A INTRINSIC
low complexity region 149 161 N/A INTRINSIC
low complexity region 242 263 N/A INTRINSIC
low complexity region 335 366 N/A INTRINSIC
low complexity region 423 443 N/A INTRINSIC
low complexity region 448 475 N/A INTRINSIC
low complexity region 480 497 N/A INTRINSIC
low complexity region 499 520 N/A INTRINSIC
Pfam:muHD 558 825 1.7e-74 PFAM
Pfam:Adap_comp_sub 657 809 1.2e-9 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000122556
Gene: ENSMUSG00000028524
AA Change: C328R

DomainStartEndE-ValueType
low complexity region 4 14 N/A INTRINSIC
low complexity region 135 156 N/A INTRINSIC
low complexity region 175 202 N/A INTRINSIC
low complexity region 207 224 N/A INTRINSIC
low complexity region 226 247 N/A INTRINSIC
Pfam:muHD 307 574 3.9e-75 PFAM
Pfam:Adap_comp_sub 404 558 3.2e-10 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SGIP1 functions as an endocytic protein that affects signaling by receptors in neuronal systems involved in energy homeostasis via its interaction with endophilins (see SH3GL3; MIM 603362) (Trevaskis et al., 2005 [PubMed 15919751] and Uezu et al., 2007 [PubMed 17626015]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass G A 6: 23,114,845 S228F probably damaging Het
Cdh23 A T 10: 60,306,122 M3062K possibly damaging Het
Cdh8 G C 8: 99,190,217 S422C probably damaging Het
Col15a1 G T 4: 47,245,544 K98N probably damaging Het
Cyp3a57 T A 5: 145,372,566 L238H probably damaging Het
Dchs2 G A 3: 83,348,194 R2399H probably benign Het
Dennd4c A C 4: 86,836,457 H1568P probably benign Het
Dkk2 T G 3: 132,177,922 C194W probably damaging Het
Dnm2 C T 9: 21,476,585 R369C probably damaging Het
Efcab7 T G 4: 99,900,580 L308* probably null Het
Elp2 T A 18: 24,606,877 N53K possibly damaging Het
Eml6 T C 11: 29,751,381 probably null Het
Erich3 G T 3: 154,762,649 E913* probably null Het
Fam159b T C 13: 104,863,706 Q3R probably benign Het
Fam186a T A 15: 99,954,875 Y154F unknown Het
Fhl3 G A 4: 124,707,522 D113N probably benign Het
Fryl A T 5: 73,059,500 M2149K probably damaging Het
Gbf1 T C 19: 46,279,941 Y1251H probably benign Het
Ghitm C A 14: 37,125,902 G262W probably null Het
Gm14325 T A 2: 177,832,842 H148L probably damaging Het
Grxcr1 C A 5: 68,032,094 N69K possibly damaging Het
Kcnma1 A G 14: 23,367,611 I846T probably damaging Het
Kdelc1 C A 1: 44,110,827 E401* probably null Het
Lama1 A G 17: 67,782,155 Y1607C possibly damaging Het
Lrp1b G C 2: 40,628,696 H175D possibly damaging Het
Lrrc2 T A 9: 110,953,182 probably null Het
Mpp3 A G 11: 102,013,325 F291L probably benign Het
Nek7 C T 1: 138,515,682 G178R probably damaging Het
Nfil3 T A 13: 52,968,605 K88* probably null Het
Nit1 A C 1: 171,343,562 V194G probably damaging Het
Nup210 T C 6: 91,040,853 M1052V probably benign Het
Nup210l A G 3: 90,136,924 T511A probably benign Het
Nwd2 G T 5: 63,804,451 M459I probably benign Het
Olfr1077-ps1 T C 2: 86,526,169 N3D probably benign Het
Peg3 A C 7: 6,708,798 S1142A probably benign Het
Phf3 T A 1: 30,820,123 K959N probably damaging Het
Piezo2 C T 18: 63,090,879 probably null Het
Pigz A G 16: 31,945,218 I365V possibly damaging Het
Plec T A 15: 76,186,618 Q860L probably damaging Het
Ppp5c T G 7: 17,006,966 D359A possibly damaging Het
Pvr C T 7: 19,909,214 A365T possibly damaging Het
Pygm G T 19: 6,393,757 G583C probably damaging Het
Rasa3 A T 8: 13,585,029 L430Q probably damaging Het
Rims2 T G 15: 39,345,515 V198G probably benign Het
Rnf38 C T 4: 44,149,224 R41H probably damaging Het
Rptn G A 3: 93,398,251 V964I probably benign Het
Rrp1b A G 17: 32,052,745 D263G probably benign Het
Sidt1 A C 16: 44,245,343 I734S probably null Het
Ssfa2 C T 2: 79,657,705 R711C probably damaging Het
Ssh1 G T 5: 113,942,575 D931E probably damaging Het
Thumpd2 C A 17: 81,044,170 R274I probably damaging Het
Tpi1 T C 6: 124,812,463 D183G probably damaging Het
Trnt1 T A 6: 106,777,922 Y205N probably damaging Het
Tsc22d2 G A 3: 58,416,814 V376M probably damaging Het
Usp34 T C 11: 23,452,569 V2454A possibly damaging Het
Uspl1 C A 5: 149,187,845 S24Y probably damaging Het
Vmn1r58 A C 7: 5,410,452 W260G possibly damaging Het
Vmn2r62 T A 7: 42,788,988 L141F probably benign Het
Zfp868 A C 8: 69,611,579 H368Q probably damaging Het
Other mutations in Sgip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00847:Sgip1 APN 4 102928921 splice site probably benign
IGL01348:Sgip1 APN 4 102915156 splice site probably null
IGL01446:Sgip1 APN 4 102928913 critical splice donor site probably null
IGL01937:Sgip1 APN 4 102966242 missense probably damaging 1.00
IGL01945:Sgip1 APN 4 102966242 missense probably damaging 1.00
IGL02249:Sgip1 APN 4 102911470 missense probably benign 0.40
IGL03232:Sgip1 APN 4 102915054 splice site probably benign
3-1:Sgip1 UTSW 4 102967663 missense probably damaging 1.00
PIT4378001:Sgip1 UTSW 4 102921083 missense unknown
R0309:Sgip1 UTSW 4 102915157 splice site probably benign
R0689:Sgip1 UTSW 4 102966252 missense probably damaging 1.00
R1563:Sgip1 UTSW 4 102966260 missense probably benign 0.38
R1715:Sgip1 UTSW 4 102915059 missense probably benign 0.09
R1899:Sgip1 UTSW 4 102968337 critical splice donor site probably null
R2286:Sgip1 UTSW 4 102867647 missense possibly damaging 0.95
R2372:Sgip1 UTSW 4 102909791 critical splice donor site probably null
R3836:Sgip1 UTSW 4 102867700 splice site probably null
R4670:Sgip1 UTSW 4 102869754 missense probably damaging 1.00
R4697:Sgip1 UTSW 4 102934587 missense probably damaging 1.00
R4725:Sgip1 UTSW 4 102966222 missense probably damaging 1.00
R4892:Sgip1 UTSW 4 102966234 missense probably damaging 1.00
R5112:Sgip1 UTSW 4 102869769 missense probably damaging 1.00
R5236:Sgip1 UTSW 4 102927587 critical splice donor site probably null
R5285:Sgip1 UTSW 4 102921477 unclassified probably benign
R5323:Sgip1 UTSW 4 102966280 missense probably damaging 1.00
R5384:Sgip1 UTSW 4 102934566 missense possibly damaging 0.46
R5386:Sgip1 UTSW 4 102915059 missense probably benign 0.09
R5682:Sgip1 UTSW 4 102967650 missense possibly damaging 0.88
R6226:Sgip1 UTSW 4 102966195 missense probably damaging 1.00
R6371:Sgip1 UTSW 4 102966285 missense probably damaging 1.00
R6594:Sgip1 UTSW 4 102962479 missense probably damaging 0.98
R6656:Sgip1 UTSW 4 102905568 intron probably benign
R6800:Sgip1 UTSW 4 102921028 unclassified probably benign
R6917:Sgip1 UTSW 4 102968191 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACTGGAGTTCTCAAGCAAGC -3'
(R):5'- TGTCAGCACAGTACACAGG -3'

Sequencing Primer
(F):5'- TCTCAAGCAAGCTAGAAGTGACTTG -3'
(R):5'- TCAGCACAGTACACAGGGTGTC -3'
Posted On2018-09-12