Incidental Mutation 'R6855:Fam186a'
ID535219
Institutional Source Beutler Lab
Gene Symbol Fam186a
Ensembl Gene ENSMUSG00000045350
Gene Namefamily with sequence similarity 186, member A
SynonymsLOC380973, 1700030F18Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R6855 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location99918348-99967061 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 99954875 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 154 (Y154F)
Ref Sequence ENSEMBL: ENSMUSP00000097783 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100209]
Predicted Effect unknown
Transcript: ENSMUST00000100209
AA Change: Y154F
SMART Domains Protein: ENSMUSP00000097783
Gene: ENSMUSG00000045350
AA Change: Y154F

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
Blast:FBG 44 222 4e-48 BLAST
coiled coil region 292 340 N/A INTRINSIC
low complexity region 423 443 N/A INTRINSIC
low complexity region 446 458 N/A INTRINSIC
low complexity region 632 644 N/A INTRINSIC
low complexity region 702 713 N/A INTRINSIC
internal_repeat_2 743 1156 1.05e-58 PROSPERO
internal_repeat_1 833 1270 7.71e-59 PROSPERO
low complexity region 1271 1285 N/A INTRINSIC
low complexity region 1289 1300 N/A INTRINSIC
low complexity region 1309 1323 N/A INTRINSIC
low complexity region 1327 1338 N/A INTRINSIC
low complexity region 1347 1361 N/A INTRINSIC
low complexity region 1365 1376 N/A INTRINSIC
low complexity region 1384 1395 N/A INTRINSIC
low complexity region 1403 1414 N/A INTRINSIC
low complexity region 1423 1437 N/A INTRINSIC
low complexity region 1441 1452 N/A INTRINSIC
low complexity region 1460 1471 N/A INTRINSIC
low complexity region 1479 1490 N/A INTRINSIC
low complexity region 1498 1509 N/A INTRINSIC
low complexity region 1518 1532 N/A INTRINSIC
low complexity region 1536 1547 N/A INTRINSIC
low complexity region 1555 1566 N/A INTRINSIC
low complexity region 1574 1585 N/A INTRINSIC
internal_repeat_1 1586 1981 7.71e-59 PROSPERO
internal_repeat_2 1737 2197 1.05e-58 PROSPERO
low complexity region 2367 2378 N/A INTRINSIC
low complexity region 2549 2564 N/A INTRINSIC
low complexity region 2644 2655 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (57/57)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass G A 6: 23,114,845 S228F probably damaging Het
Cdh23 A T 10: 60,306,122 M3062K possibly damaging Het
Cdh8 G C 8: 99,190,217 S422C probably damaging Het
Col15a1 G T 4: 47,245,544 K98N probably damaging Het
Cyp3a57 T A 5: 145,372,566 L238H probably damaging Het
Dchs2 G A 3: 83,348,194 R2399H probably benign Het
Dennd4c A C 4: 86,836,457 H1568P probably benign Het
Dkk2 T G 3: 132,177,922 C194W probably damaging Het
Dnm2 C T 9: 21,476,585 R369C probably damaging Het
Efcab7 T G 4: 99,900,580 L308* probably null Het
Elp2 T A 18: 24,606,877 N53K possibly damaging Het
Eml6 T C 11: 29,751,381 probably null Het
Erich3 G T 3: 154,762,649 E913* probably null Het
Fam159b T C 13: 104,863,706 Q3R probably benign Het
Fhl3 G A 4: 124,707,522 D113N probably benign Het
Fryl A T 5: 73,059,500 M2149K probably damaging Het
Gbf1 T C 19: 46,279,941 Y1251H probably benign Het
Ghitm C A 14: 37,125,902 G262W probably null Het
Gm14325 T A 2: 177,832,842 H148L probably damaging Het
Grxcr1 C A 5: 68,032,094 N69K possibly damaging Het
Kcnma1 A G 14: 23,367,611 I846T probably damaging Het
Kdelc1 C A 1: 44,110,827 E401* probably null Het
Lama1 A G 17: 67,782,155 Y1607C possibly damaging Het
Lrp1b G C 2: 40,628,696 H175D possibly damaging Het
Lrrc2 T A 9: 110,953,182 probably null Het
Mpp3 A G 11: 102,013,325 F291L probably benign Het
Nek7 C T 1: 138,515,682 G178R probably damaging Het
Nfil3 T A 13: 52,968,605 K88* probably null Het
Nit1 A C 1: 171,343,562 V194G probably damaging Het
Nup210 T C 6: 91,040,853 M1052V probably benign Het
Nup210l A G 3: 90,136,924 T511A probably benign Het
Nwd2 G T 5: 63,804,451 M459I probably benign Het
Olfr1077-ps1 T C 2: 86,526,169 N3D probably benign Het
Peg3 A C 7: 6,708,798 S1142A probably benign Het
Phf3 T A 1: 30,820,123 K959N probably damaging Het
Piezo2 C T 18: 63,090,879 probably null Het
Pigz A G 16: 31,945,218 I365V possibly damaging Het
Plec T A 15: 76,186,618 Q860L probably damaging Het
Ppp5c T G 7: 17,006,966 D359A possibly damaging Het
Pvr C T 7: 19,909,214 A365T possibly damaging Het
Pygm G T 19: 6,393,757 G583C probably damaging Het
Rasa3 A T 8: 13,585,029 L430Q probably damaging Het
Rims2 T G 15: 39,345,515 V198G probably benign Het
Rnf38 C T 4: 44,149,224 R41H probably damaging Het
Rptn G A 3: 93,398,251 V964I probably benign Het
Rrp1b A G 17: 32,052,745 D263G probably benign Het
Sgip1 T C 4: 102,962,376 C560R probably damaging Het
Sidt1 A C 16: 44,245,343 I734S probably null Het
Ssfa2 C T 2: 79,657,705 R711C probably damaging Het
Ssh1 G T 5: 113,942,575 D931E probably damaging Het
Thumpd2 C A 17: 81,044,170 R274I probably damaging Het
Tpi1 T C 6: 124,812,463 D183G probably damaging Het
Trnt1 T A 6: 106,777,922 Y205N probably damaging Het
Tsc22d2 G A 3: 58,416,814 V376M probably damaging Het
Usp34 T C 11: 23,452,569 V2454A possibly damaging Het
Uspl1 C A 5: 149,187,845 S24Y probably damaging Het
Vmn1r58 A C 7: 5,410,452 W260G possibly damaging Het
Vmn2r62 T A 7: 42,788,988 L141F probably benign Het
Zfp868 A C 8: 69,611,579 H368Q probably damaging Het
Other mutations in Fam186a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00588:Fam186a APN 15 99927691 splice site probably benign
IGL03047:Fam186a UTSW 15 99945708 missense unknown
R0172:Fam186a UTSW 15 99954887 missense unknown
R0194:Fam186a UTSW 15 99941763 missense possibly damaging 0.92
R0381:Fam186a UTSW 15 99942174 missense probably damaging 0.97
R0799:Fam186a UTSW 15 99942012 missense probably damaging 1.00
R1295:Fam186a UTSW 15 99939789 splice site probably benign
R1366:Fam186a UTSW 15 99943389 missense possibly damaging 0.89
R1519:Fam186a UTSW 15 99947655 missense unknown
R1592:Fam186a UTSW 15 99940318 missense probably benign 0.01
R1636:Fam186a UTSW 15 99941658 missense unknown
R1719:Fam186a UTSW 15 99942346 missense possibly damaging 0.54
R1759:Fam186a UTSW 15 99966881 nonsense probably null
R1856:Fam186a UTSW 15 99940302 missense possibly damaging 0.82
R2131:Fam186a UTSW 15 99933676 unclassified probably benign
R2192:Fam186a UTSW 15 99940311 missense possibly damaging 0.90
R2239:Fam186a UTSW 15 99954864 missense unknown
R2251:Fam186a UTSW 15 99945097 missense probably benign 0.02
R2902:Fam186a UTSW 15 99945168 missense possibly damaging 0.73
R3037:Fam186a UTSW 15 99943794 missense probably damaging 0.99
R3744:Fam186a UTSW 15 99947535 missense unknown
R4021:Fam186a UTSW 15 99941799 missense possibly damaging 0.66
R4183:Fam186a UTSW 15 99933685 unclassified probably benign
R4238:Fam186a UTSW 15 99943642 missense probably benign 0.05
R4667:Fam186a UTSW 15 99944532 missense possibly damaging 0.92
R4817:Fam186a UTSW 15 99933538 unclassified probably benign
R4835:Fam186a UTSW 15 99945808 missense unknown
R4837:Fam186a UTSW 15 99940797 missense unknown
R4897:Fam186a UTSW 15 99945277 missense possibly damaging 0.66
R4902:Fam186a UTSW 15 99946842 missense unknown
R4950:Fam186a UTSW 15 99941653 missense unknown
R4995:Fam186a UTSW 15 99945099 missense probably benign 0.27
R5062:Fam186a UTSW 15 99944646 missense possibly damaging 0.66
R5124:Fam186a UTSW 15 99943096 missense possibly damaging 0.90
R5133:Fam186a UTSW 15 99955493 missense unknown
R5424:Fam186a UTSW 15 99945763 missense unknown
R5624:Fam186a UTSW 15 99941747 missense possibly damaging 0.90
R5628:Fam186a UTSW 15 99941747 missense possibly damaging 0.90
R5637:Fam186a UTSW 15 99941747 missense possibly damaging 0.90
R5639:Fam186a UTSW 15 99947050 missense unknown
R5652:Fam186a UTSW 15 99945372 missense possibly damaging 0.79
R5673:Fam186a UTSW 15 99941747 missense possibly damaging 0.90
R5799:Fam186a UTSW 15 99966824 nonsense probably null
R5965:Fam186a UTSW 15 99945097 missense probably benign 0.37
R6044:Fam186a UTSW 15 99941997 missense probably damaging 0.97
R6077:Fam186a UTSW 15 99942703 missense possibly damaging 0.46
R6120:Fam186a UTSW 15 99940363 missense probably benign 0.00
R6185:Fam186a UTSW 15 99947649 missense unknown
R6186:Fam186a UTSW 15 99947325 missense unknown
R6242:Fam186a UTSW 15 99939907 missense unknown
R6351:Fam186a UTSW 15 99941742 missense probably damaging 0.97
R6368:Fam186a UTSW 15 99943317 missense possibly damaging 0.66
R6369:Fam186a UTSW 15 99947331 missense unknown
R6559:Fam186a UTSW 15 99944475 missense possibly damaging 0.46
R6867:Fam186a UTSW 15 99945850 missense unknown
R6957:Fam186a UTSW 15 99946476 missense unknown
R6961:Fam186a UTSW 15 99940201 missense probably benign 0.16
R6994:Fam186a UTSW 15 99942466 missense probably benign 0.35
R6996:Fam186a UTSW 15 99955493 missense unknown
R7062:Fam186a UTSW 15 99933640 unclassified probably benign
R7064:Fam186a UTSW 15 99941676 missense unknown
X0021:Fam186a UTSW 15 99945435 missense probably benign 0.00
Z1088:Fam186a UTSW 15 99945994 missense unknown
Predicted Primers PCR Primer
(F):5'- ATGAGACTCTGAGTTCAGCCG -3'
(R):5'- TTGCTCAGGTCAACCCAAATACAAG -3'

Sequencing Primer
(F):5'- TAGTGCTCTTGACCACGGAAC -3'
(R):5'- TACAAGATAACTATTCCCCAGTGG -3'
Posted On2018-09-12