Incidental Mutation 'R6855:Rrp1b'
ID535222
Institutional Source Beutler Lab
Gene Symbol Rrp1b
Ensembl Gene ENSMUSG00000058392
Gene Nameribosomal RNA processing 1 homolog B (S. cerevisiae)
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.329) question?
Stock #R6855 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location32036100-32062865 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 32052745 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 263 (D263G)
Ref Sequence ENSEMBL: ENSMUSP00000080085 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081339] [ENSMUST00000151808]
Predicted Effect probably benign
Transcript: ENSMUST00000081339
AA Change: D263G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000080085
Gene: ENSMUSG00000058392
AA Change: D263G

DomainStartEndE-ValueType
Pfam:Nop52 10 218 3.3e-73 PFAM
low complexity region 344 352 N/A INTRINSIC
low complexity region 376 384 N/A INTRINSIC
low complexity region 450 463 N/A INTRINSIC
low complexity region 483 496 N/A INTRINSIC
low complexity region 694 706 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151808
SMART Domains Protein: ENSMUSP00000123044
Gene: ENSMUSG00000058392

DomainStartEndE-ValueType
Pfam:Nop52 8 77 1.9e-25 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (57/57)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass G A 6: 23,114,845 S228F probably damaging Het
Cdh23 A T 10: 60,306,122 M3062K possibly damaging Het
Cdh8 G C 8: 99,190,217 S422C probably damaging Het
Col15a1 G T 4: 47,245,544 K98N probably damaging Het
Cyp3a57 T A 5: 145,372,566 L238H probably damaging Het
Dchs2 G A 3: 83,348,194 R2399H probably benign Het
Dennd4c A C 4: 86,836,457 H1568P probably benign Het
Dkk2 T G 3: 132,177,922 C194W probably damaging Het
Dnm2 C T 9: 21,476,585 R369C probably damaging Het
Efcab7 T G 4: 99,900,580 L308* probably null Het
Elp2 T A 18: 24,606,877 N53K possibly damaging Het
Eml6 T C 11: 29,751,381 probably null Het
Erich3 G T 3: 154,762,649 E913* probably null Het
Fam159b T C 13: 104,863,706 Q3R probably benign Het
Fam186a T A 15: 99,954,875 Y154F unknown Het
Fhl3 G A 4: 124,707,522 D113N probably benign Het
Fryl A T 5: 73,059,500 M2149K probably damaging Het
Gbf1 T C 19: 46,279,941 Y1251H probably benign Het
Ghitm C A 14: 37,125,902 G262W probably null Het
Gm14325 T A 2: 177,832,842 H148L probably damaging Het
Grxcr1 C A 5: 68,032,094 N69K possibly damaging Het
Kcnma1 A G 14: 23,367,611 I846T probably damaging Het
Kdelc1 C A 1: 44,110,827 E401* probably null Het
Lama1 A G 17: 67,782,155 Y1607C possibly damaging Het
Lrp1b G C 2: 40,628,696 H175D possibly damaging Het
Lrrc2 T A 9: 110,953,182 probably null Het
Mpp3 A G 11: 102,013,325 F291L probably benign Het
Nek7 C T 1: 138,515,682 G178R probably damaging Het
Nfil3 T A 13: 52,968,605 K88* probably null Het
Nit1 A C 1: 171,343,562 V194G probably damaging Het
Nup210 T C 6: 91,040,853 M1052V probably benign Het
Nup210l A G 3: 90,136,924 T511A probably benign Het
Nwd2 G T 5: 63,804,451 M459I probably benign Het
Olfr1077-ps1 T C 2: 86,526,169 N3D probably benign Het
Peg3 A C 7: 6,708,798 S1142A probably benign Het
Phf3 T A 1: 30,820,123 K959N probably damaging Het
Piezo2 C T 18: 63,090,879 probably null Het
Pigz A G 16: 31,945,218 I365V possibly damaging Het
Plec T A 15: 76,186,618 Q860L probably damaging Het
Ppp5c T G 7: 17,006,966 D359A possibly damaging Het
Pvr C T 7: 19,909,214 A365T possibly damaging Het
Pygm G T 19: 6,393,757 G583C probably damaging Het
Rasa3 A T 8: 13,585,029 L430Q probably damaging Het
Rims2 T G 15: 39,345,515 V198G probably benign Het
Rnf38 C T 4: 44,149,224 R41H probably damaging Het
Rptn G A 3: 93,398,251 V964I probably benign Het
Sgip1 T C 4: 102,962,376 C560R probably damaging Het
Sidt1 A C 16: 44,245,343 I734S probably null Het
Ssfa2 C T 2: 79,657,705 R711C probably damaging Het
Ssh1 G T 5: 113,942,575 D931E probably damaging Het
Thumpd2 C A 17: 81,044,170 R274I probably damaging Het
Tpi1 T C 6: 124,812,463 D183G probably damaging Het
Trnt1 T A 6: 106,777,922 Y205N probably damaging Het
Tsc22d2 G A 3: 58,416,814 V376M probably damaging Het
Usp34 T C 11: 23,452,569 V2454A possibly damaging Het
Uspl1 C A 5: 149,187,845 S24Y probably damaging Het
Vmn1r58 A C 7: 5,410,452 W260G possibly damaging Het
Vmn2r62 T A 7: 42,788,988 L141F probably benign Het
Zfp868 A C 8: 69,611,579 H368Q probably damaging Het
Other mutations in Rrp1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01114:Rrp1b APN 17 32052819 missense probably benign 0.09
IGL01383:Rrp1b APN 17 32058578 missense probably damaging 0.99
IGL02740:Rrp1b APN 17 32059331 missense probably damaging 1.00
IGL03030:Rrp1b APN 17 32056901 missense probably damaging 1.00
IGL03181:Rrp1b APN 17 32057176 missense probably benign 0.13
IGL03396:Rrp1b APN 17 32057263 splice site probably benign
IGL02980:Rrp1b UTSW 17 32050039 missense possibly damaging 0.49
R0138:Rrp1b UTSW 17 32060452 missense probably benign 0.24
R0394:Rrp1b UTSW 17 32058564 missense probably benign 0.34
R0681:Rrp1b UTSW 17 32060395 missense probably damaging 1.00
R1315:Rrp1b UTSW 17 32056639 missense probably benign 0.00
R1351:Rrp1b UTSW 17 32056637 missense possibly damaging 0.82
R1700:Rrp1b UTSW 17 32057204 missense probably benign 0.19
R1815:Rrp1b UTSW 17 32056811 missense probably benign
R1940:Rrp1b UTSW 17 32056845 missense possibly damaging 0.95
R2176:Rrp1b UTSW 17 32056560 missense probably benign 0.00
R2352:Rrp1b UTSW 17 32059328 missense possibly damaging 0.71
R2975:Rrp1b UTSW 17 32058573 missense probably damaging 1.00
R4552:Rrp1b UTSW 17 32056010 splice site probably benign
R5114:Rrp1b UTSW 17 32036471 utr 5 prime probably benign
R5242:Rrp1b UTSW 17 32051703 missense possibly damaging 0.82
R5647:Rrp1b UTSW 17 32056011 splice site probably benign
R5739:Rrp1b UTSW 17 32045976 missense probably damaging 1.00
R5853:Rrp1b UTSW 17 32056684 missense possibly damaging 0.49
R5878:Rrp1b UTSW 17 32047675 missense probably damaging 1.00
R6389:Rrp1b UTSW 17 32056627 missense possibly damaging 0.55
R6734:Rrp1b UTSW 17 32055304 intron probably benign
R6742:Rrp1b UTSW 17 32056934 missense probably benign
R6759:Rrp1b UTSW 17 32057089 missense probably benign 0.01
R7014:Rrp1b UTSW 17 32049427 missense probably damaging 1.00
R7315:Rrp1b UTSW 17 32058571 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TTGGTCCTAGGGGCAAAACC -3'
(R):5'- CCAACAAGCTCATTCTAAGAATGGTG -3'

Sequencing Primer
(F):5'- GCAAAACCTGGAGCTTCGC -3'
(R):5'- AGGACTTTACAATTTAAGCCTTATGG -3'
Posted On2018-09-12