Incidental Mutation 'R6855:Gbf1'
ID535228
Institutional Source Beutler Lab
Gene Symbol Gbf1
Ensembl Gene ENSMUSG00000025224
Gene Namegolgi-specific brefeldin A-resistance factor 1
Synonyms1700083E03Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.979) question?
Stock #R6855 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location46152509-46286510 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 46279941 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 1251 (Y1251H)
Ref Sequence ENSEMBL: ENSMUSP00000135062 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026254] [ENSMUST00000175747] [ENSMUST00000176992]
Predicted Effect probably benign
Transcript: ENSMUST00000026254
AA Change: Y1305H

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000026254
Gene: ENSMUSG00000025224
AA Change: Y1305H

DomainStartEndE-ValueType
low complexity region 270 288 N/A INTRINSIC
Pfam:Sec7_N 400 551 3.4e-29 PFAM
Sec7 696 884 8.55e-91 SMART
low complexity region 1198 1216 N/A INTRINSIC
low complexity region 1281 1296 N/A INTRINSIC
low complexity region 1773 1793 N/A INTRINSIC
low complexity region 1802 1820 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175747
Predicted Effect probably benign
Transcript: ENSMUST00000176992
AA Change: Y1251H

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000135062
Gene: ENSMUSG00000025224
AA Change: Y1251H

DomainStartEndE-ValueType
low complexity region 216 234 N/A INTRINSIC
Pfam:Sec7_N 343 498 1.5e-35 PFAM
Sec7 642 830 8.55e-91 SMART
low complexity region 1144 1162 N/A INTRINSIC
low complexity region 1227 1242 N/A INTRINSIC
low complexity region 1715 1735 N/A INTRINSIC
low complexity region 1744 1762 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Sec7 domain family. The encoded protein is a guanine nucleotide exchange factor that regulates the recruitment of proteins to membranes by mediating GDP to GTP exchange. The encoded protein is localized to the Golgi apparatus and plays a role in vesicular trafficking by activating ADP ribosylation factor 1. The encoded protein has also been identified as an important host factor for viral replication. Multiple transcript variants have been observed for this gene. [provided by RefSeq, Dec 2010]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass G A 6: 23,114,845 S228F probably damaging Het
Cdh23 A T 10: 60,306,122 M3062K possibly damaging Het
Cdh8 G C 8: 99,190,217 S422C probably damaging Het
Col15a1 G T 4: 47,245,544 K98N probably damaging Het
Cyp3a57 T A 5: 145,372,566 L238H probably damaging Het
Dchs2 G A 3: 83,348,194 R2399H probably benign Het
Dennd4c A C 4: 86,836,457 H1568P probably benign Het
Dkk2 T G 3: 132,177,922 C194W probably damaging Het
Dnm2 C T 9: 21,476,585 R369C probably damaging Het
Efcab7 T G 4: 99,900,580 L308* probably null Het
Elp2 T A 18: 24,606,877 N53K possibly damaging Het
Eml6 T C 11: 29,751,381 probably null Het
Erich3 G T 3: 154,762,649 E913* probably null Het
Fam159b T C 13: 104,863,706 Q3R probably benign Het
Fam186a T A 15: 99,954,875 Y154F unknown Het
Fhl3 G A 4: 124,707,522 D113N probably benign Het
Fryl A T 5: 73,059,500 M2149K probably damaging Het
Ghitm C A 14: 37,125,902 G262W probably null Het
Gm14325 T A 2: 177,832,842 H148L probably damaging Het
Grxcr1 C A 5: 68,032,094 N69K possibly damaging Het
Kcnma1 A G 14: 23,367,611 I846T probably damaging Het
Kdelc1 C A 1: 44,110,827 E401* probably null Het
Lama1 A G 17: 67,782,155 Y1607C possibly damaging Het
Lrp1b G C 2: 40,628,696 H175D possibly damaging Het
Lrrc2 T A 9: 110,953,182 probably null Het
Mpp3 A G 11: 102,013,325 F291L probably benign Het
Nek7 C T 1: 138,515,682 G178R probably damaging Het
Nfil3 T A 13: 52,968,605 K88* probably null Het
Nit1 A C 1: 171,343,562 V194G probably damaging Het
Nup210 T C 6: 91,040,853 M1052V probably benign Het
Nup210l A G 3: 90,136,924 T511A probably benign Het
Nwd2 G T 5: 63,804,451 M459I probably benign Het
Olfr1077-ps1 T C 2: 86,526,169 N3D probably benign Het
Peg3 A C 7: 6,708,798 S1142A probably benign Het
Phf3 T A 1: 30,820,123 K959N probably damaging Het
Piezo2 C T 18: 63,090,879 probably null Het
Pigz A G 16: 31,945,218 I365V possibly damaging Het
Plec T A 15: 76,186,618 Q860L probably damaging Het
Ppp5c T G 7: 17,006,966 D359A possibly damaging Het
Pvr C T 7: 19,909,214 A365T possibly damaging Het
Pygm G T 19: 6,393,757 G583C probably damaging Het
Rasa3 A T 8: 13,585,029 L430Q probably damaging Het
Rims2 T G 15: 39,345,515 V198G probably benign Het
Rnf38 C T 4: 44,149,224 R41H probably damaging Het
Rptn G A 3: 93,398,251 V964I probably benign Het
Rrp1b A G 17: 32,052,745 D263G probably benign Het
Sgip1 T C 4: 102,962,376 C560R probably damaging Het
Sidt1 A C 16: 44,245,343 I734S probably null Het
Ssfa2 C T 2: 79,657,705 R711C probably damaging Het
Ssh1 G T 5: 113,942,575 D931E probably damaging Het
Thumpd2 C A 17: 81,044,170 R274I probably damaging Het
Tpi1 T C 6: 124,812,463 D183G probably damaging Het
Trnt1 T A 6: 106,777,922 Y205N probably damaging Het
Tsc22d2 G A 3: 58,416,814 V376M probably damaging Het
Usp34 T C 11: 23,452,569 V2454A possibly damaging Het
Uspl1 C A 5: 149,187,845 S24Y probably damaging Het
Vmn1r58 A C 7: 5,410,452 W260G possibly damaging Het
Vmn2r62 T A 7: 42,788,988 L141F probably benign Het
Zfp868 A C 8: 69,611,579 H368Q probably damaging Het
Other mutations in Gbf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Gbf1 APN 19 46284249 critical splice acceptor site probably null
IGL00988:Gbf1 APN 19 46284120 critical splice donor site probably null
IGL01352:Gbf1 APN 19 46265215 missense probably damaging 1.00
IGL01432:Gbf1 APN 19 46279995 missense probably damaging 1.00
IGL01469:Gbf1 APN 19 46279364 missense probably damaging 1.00
IGL01870:Gbf1 APN 19 46285669 missense probably benign 0.00
IGL02019:Gbf1 APN 19 46279292 missense possibly damaging 0.93
IGL02061:Gbf1 APN 19 46279258 missense possibly damaging 0.65
IGL02126:Gbf1 APN 19 46252117 missense probably damaging 0.97
IGL02272:Gbf1 APN 19 46269803 missense probably damaging 1.00
IGL02346:Gbf1 APN 19 46285930 missense probably damaging 1.00
IGL02491:Gbf1 APN 19 46262540 unclassified probably benign
IGL03003:Gbf1 APN 19 46255655 missense probably damaging 1.00
IGL03130:Gbf1 APN 19 46267348 missense possibly damaging 0.82
IGL03376:Gbf1 APN 19 46262521 missense possibly damaging 0.94
PIT4651001:Gbf1 UTSW 19 46163543 missense probably benign
R0107:Gbf1 UTSW 19 46284828 missense probably benign
R0139:Gbf1 UTSW 19 46261792 missense probably damaging 1.00
R0180:Gbf1 UTSW 19 46285722 missense probably benign
R0255:Gbf1 UTSW 19 46254110 splice site probably benign
R0317:Gbf1 UTSW 19 46254020 missense probably benign
R0329:Gbf1 UTSW 19 46272270 critical splice donor site probably null
R0372:Gbf1 UTSW 19 46285704 missense probably benign
R0666:Gbf1 UTSW 19 46262544 unclassified probably benign
R1463:Gbf1 UTSW 19 46271545 unclassified probably benign
R1701:Gbf1 UTSW 19 46261675 missense probably damaging 1.00
R1848:Gbf1 UTSW 19 46272037 missense possibly damaging 0.90
R1962:Gbf1 UTSW 19 46267219 missense probably damaging 1.00
R1965:Gbf1 UTSW 19 46271564 missense probably damaging 1.00
R1966:Gbf1 UTSW 19 46271564 missense probably damaging 1.00
R2177:Gbf1 UTSW 19 46265670 missense probably benign
R2238:Gbf1 UTSW 19 46163618 missense probably benign
R2239:Gbf1 UTSW 19 46163618 missense probably benign
R2520:Gbf1 UTSW 19 46265367 missense probably benign
R3821:Gbf1 UTSW 19 46264807 missense probably damaging 0.99
R4681:Gbf1 UTSW 19 46280550 missense probably benign 0.41
R4695:Gbf1 UTSW 19 46259167 nonsense probably null
R4785:Gbf1 UTSW 19 46268395 missense possibly damaging 0.89
R5202:Gbf1 UTSW 19 46268454 missense probably benign 0.13
R5359:Gbf1 UTSW 19 46283725 critical splice donor site probably null
R5468:Gbf1 UTSW 19 46284296 missense possibly damaging 0.92
R5593:Gbf1 UTSW 19 46272524 missense possibly damaging 0.91
R5595:Gbf1 UTSW 19 46284422 missense possibly damaging 0.74
R5796:Gbf1 UTSW 19 46284343 missense probably benign 0.08
R5938:Gbf1 UTSW 19 46268452 missense probably damaging 1.00
R5957:Gbf1 UTSW 19 46246221 critical splice donor site probably null
R6059:Gbf1 UTSW 19 46265248 missense probably damaging 1.00
R6120:Gbf1 UTSW 19 46279321 missense possibly damaging 0.83
R6239:Gbf1 UTSW 19 46259696 missense probably benign 0.00
R6252:Gbf1 UTSW 19 46271556 missense probably benign 0.33
R6310:Gbf1 UTSW 19 46280005 missense probably damaging 0.96
R6787:Gbf1 UTSW 19 46271772 missense probably benign
R6805:Gbf1 UTSW 19 46262507 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGATGTTGTCCAGACCTCTAC -3'
(R):5'- TATAAGCTGGGGCCCCATTC -3'

Sequencing Primer
(F):5'- GATGTTGTCCAGACCTCTACCTTTTG -3'
(R):5'- TCTCTGAGAACTAAGACCCTTTTG -3'
Posted On2018-09-12