Incidental Mutation 'R6856:Pax3'
ID535229
Institutional Source Beutler Lab
Gene Symbol Pax3
Ensembl Gene ENSMUSG00000004872
Gene Namepaired box 3
SynonymsPax-3
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.761) question?
Stock #R6856 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location78101267-78197134 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 78132419 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 201 (S201P)
Ref Sequence ENSEMBL: ENSMUSP00000004994 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004994] [ENSMUST00000087086]
Predicted Effect probably benign
Transcript: ENSMUST00000004994
AA Change: S201P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000004994
Gene: ENSMUSG00000004872
AA Change: S201P

DomainStartEndE-ValueType
PAX 34 159 1.99e-91 SMART
low complexity region 164 185 N/A INTRINSIC
HOX 219 281 6.6e-27 SMART
Pfam:Pax7 347 391 5.9e-29 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000087086
AA Change: S201P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000084320
Gene: ENSMUSG00000004872
AA Change: S201P

DomainStartEndE-ValueType
PAX 34 159 1.99e-91 SMART
low complexity region 164 185 N/A INTRINSIC
HOX 219 281 6.6e-27 SMART
Pfam:Pax7 346 391 5.3e-27 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the paired box (PAX) family of transcription factors. Members of the PAX family typically contain a paired box domain and a paired-type homeodomain. These genes play critical roles during fetal development. Mutations in paired box gene 3 are associated with Waardenburg syndrome, craniofacial-deafness-hand syndrome, and alveolar rhabdomyosarcoma. The translocation t(2;13)(q35;q14), which represents a fusion between PAX3 and the forkhead gene, is a frequent finding in alveolar rhabdomyosarcoma. Alternative splicing results in transcripts encoding isoforms with different C-termini. [provided by RefSeq, Jul 2008]
PHENOTYPE: Effects on homozygotes for mutations in this gene vary in severity and include embryonic to perinatal death, malformations of neural tube, spinal ganglia, heart, vertebral column, hindbrain and limb musculature. Heterozygotes have white belly spots and variable spotting on the back and extremeties. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl4 A G 3: 151,500,118 M156V probably benign Het
Aire A T 10: 78,030,255 F549I probably damaging Het
Ankk1 T C 9: 49,420,020 E230G probably benign Het
Anp32a A T 9: 62,372,115 K86N possibly damaging Het
Aqp4 T C 18: 15,399,896 I47V possibly damaging Het
Arap3 A G 18: 37,979,863 V1098A possibly damaging Het
Ascc3 T A 10: 50,749,062 W1652R probably damaging Het
Atad2 T A 15: 58,106,813 H464L probably damaging Het
Brca2 C A 5: 150,540,208 H1146N possibly damaging Het
Capn9 G A 8: 124,597,569 V203M probably damaging Het
Ccr6 T A 17: 8,256,049 S29T probably benign Het
Cfap99 G T 5: 34,310,217 probably null Het
Cpt1c C T 7: 44,959,918 G716S probably damaging Het
Dhx29 A T 13: 112,952,861 Q722L probably benign Het
Dmxl1 C T 18: 49,852,288 R201* probably null Het
Dsg2 G A 18: 20,601,802 G946S probably damaging Het
Erg C A 16: 95,368,651 probably null Het
Fam198b G T 3: 79,886,141 probably benign Het
Fbxo32 G A 15: 58,214,641 probably benign Het
Glis1 T G 4: 107,435,879 D66E probably damaging Het
Gm21671 A G 5: 25,950,845 I167T probably benign Het
Grm6 A T 11: 50,859,825 N605I probably damaging Het
Gtf3c6 T C 10: 40,249,672 E183G probably benign Het
Herc1 A G 9: 66,397,898 M861V probably benign Het
Igkv12-41 A T 6: 69,858,529 S80T probably damaging Het
Kcnt2 T C 1: 140,596,004 S1057P probably damaging Het
Krt36 T G 11: 100,103,390 Q287P probably damaging Het
Ldhd A G 8: 111,630,274 S13P probably benign Het
Lmtk3 T A 7: 45,794,297 S801R probably benign Het
Lrp2 A T 2: 69,513,268 F916I probably damaging Het
Map4k1 A T 7: 28,986,834 I138F probably damaging Het
Naa25 A T 5: 121,438,804 K872M probably damaging Het
Nek3 C A 8: 22,129,447 G443V probably damaging Het
Noxred1 T C 12: 87,227,036 E77G probably benign Het
Nup210 G A 6: 91,087,913 Q202* probably null Het
Olfr1065 G T 2: 86,445,907 S25Y probably benign Het
Olfr646 A T 7: 104,106,791 M171L probably benign Het
Pcdhgb5 T A 18: 37,733,404 Y751N probably benign Het
Pign A T 1: 105,553,895 L792* probably null Het
Pkd1 T C 17: 24,573,493 F1385L probably benign Het
Plxnb2 A C 15: 89,164,320 C629G probably benign Het
Prpsap2 A T 11: 61,730,271 I328N probably benign Het
Prrc2c A G 1: 162,682,371 L2319P probably damaging Het
Ptgfrn T C 3: 101,045,446 D824G probably damaging Het
Ptpra G A 2: 130,519,381 S204N probably damaging Het
Pygm G T 19: 6,393,757 G671C probably damaging Het
Rap1a A G 3: 105,732,068 F92L probably damaging Het
Slmap A T 14: 26,430,092 probably null Het
Spdye4c A G 2: 128,596,130 probably null Het
Ssfa2 C T 2: 79,657,705 R711C probably damaging Het
Stk11 C A 10: 80,128,090 F97L probably benign Het
Tbc1d9b G A 11: 50,168,746 A992T probably benign Het
Tmem232 G A 17: 65,450,310 T296M possibly damaging Het
Trim33 C T 3: 103,352,049 T1018M probably damaging Het
Trpv2 A C 11: 62,584,615 I285L probably benign Het
Usp46 A G 5: 74,028,934 Y110H probably benign Het
Vmn1r27 T A 6: 58,215,447 M191L possibly damaging Het
Vwf G T 6: 125,642,150 E1264* probably null Het
Zfp109 A T 7: 24,229,398 N195K probably benign Het
Zfp385b T A 2: 77,415,794 L296F probably damaging Het
Zfp839 T A 12: 110,866,761 Y591* probably null Het
Other mutations in Pax3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01642:Pax3 APN 1 78196663 unclassified probably null
IGL02249:Pax3 APN 1 78195325 missense probably damaging 0.98
IGL02271:Pax3 APN 1 78195332 missense probably damaging 1.00
IGL02376:Pax3 APN 1 78132292 missense probably damaging 1.00
IGL02530:Pax3 APN 1 78121787 missense possibly damaging 0.87
IGL02950:Pax3 APN 1 78103360 missense probably benign 0.06
Nidoqueen UTSW 1 78132232 missense probably damaging 1.00
stemware UTSW 1 78132347 missense
Widget UTSW 1 78122590 critical splice donor site probably null
R0049:Pax3 UTSW 1 78103504 missense probably damaging 1.00
R0049:Pax3 UTSW 1 78103504 missense probably damaging 1.00
R0523:Pax3 UTSW 1 78195441 missense possibly damaging 0.83
R1575:Pax3 UTSW 1 78103484 missense probably benign 0.00
R1831:Pax3 UTSW 1 78132340 missense probably damaging 1.00
R1934:Pax3 UTSW 1 78103480 missense possibly damaging 0.90
R2420:Pax3 UTSW 1 78196864 unclassified probably null
R2473:Pax3 UTSW 1 78122590 critical splice donor site probably null
R4430:Pax3 UTSW 1 78195324 missense probably damaging 1.00
R4693:Pax3 UTSW 1 78196746 missense probably benign 0.00
R4818:Pax3 UTSW 1 78132232 missense probably damaging 1.00
R4860:Pax3 UTSW 1 78192456 missense possibly damaging 0.78
R4860:Pax3 UTSW 1 78192456 missense possibly damaging 0.78
R5302:Pax3 UTSW 1 78121612 missense possibly damaging 0.88
R5475:Pax3 UTSW 1 78103418 missense probably benign 0.06
R5855:Pax3 UTSW 1 78121651 missense probably damaging 0.99
R6102:Pax3 UTSW 1 78132347 missense probably damaging 1.00
R6190:Pax3 UTSW 1 78192549 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- AACGAAAACGGTTCCCATGAG -3'
(R):5'- CTGAAAGCCATTTAATAGCCCG -3'

Sequencing Primer
(F):5'- ACATCCGGGCATCAGTACCTG -3'
(R):5'- GCCATTTAATAGCCCGATAGTGTG -3'
Posted OnSep 12, 2018