Incidental Mutation 'R6856:Usp46'
ID535247
Institutional Source Beutler Lab
Gene Symbol Usp46
Ensembl Gene ENSMUSG00000054814
Gene Nameubiquitin specific peptidase 46
Synonyms1190009E20Rik, 2410018I08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.196) question?
Stock #R6856 (G1)
Quality Score104.008
Status Not validated
Chromosome5
Chromosomal Location73998453-74068431 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 74028934 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000114395 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068058] [ENSMUST00000119154] [ENSMUST00000145016] [ENSMUST00000152408]
Predicted Effect probably benign
Transcript: ENSMUST00000068058
SMART Domains Protein: ENSMUSP00000070554
Gene: ENSMUSG00000054814

DomainStartEndE-ValueType
Pfam:UCH 34 362 6.8e-67 PFAM
Pfam:UCH_1 35 335 1.5e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119154
SMART Domains Protein: ENSMUSP00000114060
Gene: ENSMUSG00000054814

DomainStartEndE-ValueType
Pfam:UCH 9 335 4.1e-67 PFAM
Pfam:UCH_1 11 308 2.9e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145016
SMART Domains Protein: ENSMUSP00000114395
Gene: ENSMUSG00000054814

DomainStartEndE-ValueType
Pfam:UCH 27 122 4.4e-30 PFAM
Pfam:UCH_1 28 122 3.6e-13 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000152408
AA Change: Y110H
SMART Domains Protein: ENSMUSP00000144284
Gene: ENSMUSG00000054814
AA Change: Y110H

DomainStartEndE-ValueType
Pfam:UCH 1 132 1e-9 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Modification of cellular proteins by ubiquitin is an essential regulatory mechanism controlled by the coordinated action of multiple ubiquitin-conjugating and deubiquitinating enzymes. USP46 belongs to a large family of cysteine proteases that function as deubiquitinating enzymes (Quesada et al., 2004 [PubMed 14715245]).[supplied by OMIM, Jun 2009]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit reduced depression-related behaviors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl4 A G 3: 151,500,118 M156V probably benign Het
Aire A T 10: 78,030,255 F546I probably damaging Het
Ankk1 T C 9: 49,420,020 E230G probably benign Het
Anp32a A T 9: 62,372,115 K86N possibly damaging Het
Aqp4 T C 18: 15,399,896 I47V possibly damaging Het
Arap3 A G 18: 37,979,863 V1098A possibly damaging Het
Ascc3 T A 10: 50,749,062 W1652R probably damaging Het
Atad2 T A 15: 58,106,813 H464L probably damaging Het
Brca2 C A 5: 150,540,208 H1146N possibly damaging Het
Capn9 G A 8: 124,597,569 V203M probably damaging Het
Ccr6 T A 17: 8,256,049 S29T probably benign Het
Cfap99 G T 5: 34,310,217 probably null Het
Cpt1c C T 7: 44,959,918 G716S probably damaging Het
Dhx29 A T 13: 112,952,861 Q722L probably benign Het
Dmxl1 C T 18: 49,852,288 R201* probably null Het
Dsg2 G A 18: 20,601,802 G946S probably damaging Het
Erg C A 16: 95,368,651 probably null Het
Fam198b G T 3: 79,886,141 probably benign Het
Fbxo32 G A 15: 58,214,641 probably benign Het
Glis1 T G 4: 107,435,879 D66E probably damaging Het
Gm21671 A G 5: 25,950,845 I167T probably benign Het
Grm6 A T 11: 50,859,825 N605I probably damaging Het
Gtf3c6 T C 10: 40,249,672 E183G probably benign Het
Herc1 A G 9: 66,397,898 M861V probably benign Het
Igkv12-41 A T 6: 69,858,529 S80T probably damaging Het
Kcnt2 T C 1: 140,596,004 S1057P probably damaging Het
Krt36 T G 11: 100,103,390 Q287P probably damaging Het
Ldhd A G 8: 111,630,274 S13P probably benign Het
Lmtk3 T A 7: 45,794,297 probably benign Het
Lrp2 A T 2: 69,513,268 F916I probably damaging Het
Map4k1 A T 7: 28,986,834 I92F probably damaging Het
Naa25 A T 5: 121,438,804 K872M probably damaging Het
Nek3 C A 8: 22,129,447 G443V probably damaging Het
Noxred1 T C 12: 87,227,036 E77G probably benign Het
Nup210 G A 6: 91,087,913 Q202* probably null Het
Olfr1065 G T 2: 86,445,907 S25Y probably benign Het
Olfr646 A T 7: 104,106,791 M171L probably benign Het
Pax3 A G 1: 78,132,419 S201P probably damaging Het
Pcdhgb5 T A 18: 37,733,404 Y751N probably benign Het
Pign A T 1: 105,553,895 L792* probably null Het
Pkd1 T C 17: 24,573,493 F1385L probably benign Het
Plxnb2 A C 15: 89,164,320 C629G probably benign Het
Prpsap2 A T 11: 61,730,271 I328N probably benign Het
Prrc2c A G 1: 162,682,371 L2317P probably damaging Het
Ptgfrn T C 3: 101,045,446 D824G probably damaging Het
Ptpra G A 2: 130,519,381 S204N probably damaging Het
Pygm G T 19: 6,393,757 G583C probably damaging Het
Rap1a A G 3: 105,732,068 F92L probably damaging Het
Slmap A T 14: 26,430,092 probably null Het
Spdye4c A G 2: 128,596,130 probably null Het
Ssfa2 C T 2: 79,657,705 R711C probably damaging Het
Stk11 C A 10: 80,128,090 F97L probably benign Het
Tbc1d9b G A 11: 50,168,746 A992T probably benign Het
Tmem232 G A 17: 65,450,310 T296M possibly damaging Het
Trim33 C T 3: 103,352,049 T1018M probably damaging Het
Trpv2 A C 11: 62,584,615 I285L probably benign Het
Vmn1r27 T A 6: 58,215,447 M191L possibly damaging Het
Vwf G T 6: 125,642,150 E1264* probably null Het
Zfp109 A T 7: 24,229,398 N195K probably benign Het
Zfp385b T A 2: 77,415,794 L208F probably damaging Het
Zfp839 T A 12: 110,866,761 Y515* probably null Het
Other mutations in Usp46
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Usp46 APN 5 74002686 missense probably null 0.03
IGL00401:Usp46 APN 5 74003171 missense probably damaging 1.00
IGL00949:Usp46 APN 5 74003242 missense possibly damaging 0.67
IGL02108:Usp46 APN 5 74029206 missense probably damaging 1.00
IGL02325:Usp46 APN 5 74037028 splice site probably null
IGL02383:Usp46 APN 5 74029353 missense probably benign 0.22
IGL02400:Usp46 APN 5 74037052 missense probably benign 0.00
IGL02833:Usp46 APN 5 74016682 missense probably benign 0.01
R0091:Usp46 UTSW 5 74003257 missense probably benign 0.25
R1186:Usp46 UTSW 5 74002122 missense probably benign 0.01
R1714:Usp46 UTSW 5 74003167 missense probably benign 0.35
R4023:Usp46 UTSW 5 74032475 missense probably damaging 1.00
R4051:Usp46 UTSW 5 74002755 missense probably benign 0.01
R4239:Usp46 UTSW 5 74032267 unclassified probably benign
R4240:Usp46 UTSW 5 74032267 unclassified probably benign
R5542:Usp46 UTSW 5 74029241 missense probably benign 0.03
R5907:Usp46 UTSW 5 74037085 missense probably benign 0.05
R6442:Usp46 UTSW 5 74016716 missense probably benign 0.01
R6770:Usp46 UTSW 5 74032354 missense probably benign 0.00
R7080:Usp46 UTSW 5 74016683 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- TGAGCTCTTCATGGTGAGAACC -3'
(R):5'- ATGCTTGAACTGTGAAACTGTG -3'

Sequencing Primer
(F):5'- AGAACCTTATTAAGTGGGTCACGGTC -3'
(R):5'- GCTTGAACTGTGAAACTGTGAGTAC -3'
Posted On2018-09-12