Incidental Mutation 'R6856:Nek3'
ID535259
Institutional Source Beutler Lab
Gene Symbol Nek3
Ensembl Gene ENSMUSG00000031478
Gene NameNIMA (never in mitosis gene a)-related expressed kinase 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6856 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location22128283-22166435 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 22129447 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Valine at position 443 (G443V)
Ref Sequence ENSEMBL: ENSMUSP00000136876 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033865] [ENSMUST00000110730] [ENSMUST00000169834] [ENSMUST00000178324] [ENSMUST00000209656]
Predicted Effect probably damaging
Transcript: ENSMUST00000033865
AA Change: G441V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000033865
Gene: ENSMUSG00000031478
AA Change: G441V

DomainStartEndE-ValueType
S_TKc 4 259 1.11e-89 SMART
Blast:S_TKc 267 444 8e-49 BLAST
low complexity region 471 485 N/A INTRINSIC
low complexity region 495 506 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110730
AA Change: G443V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106358
Gene: ENSMUSG00000031478
AA Change: G443V

DomainStartEndE-ValueType
S_TKc 4 259 1.11e-89 SMART
Blast:S_TKc 267 446 1e-48 BLAST
low complexity region 473 487 N/A INTRINSIC
low complexity region 497 508 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169834
SMART Domains Protein: ENSMUSP00000126705
Gene: ENSMUSG00000037738

DomainStartEndE-ValueType
S_TKc 4 255 3.77e-92 SMART
Blast:S_TKc 396 497 3e-37 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000178324
AA Change: G443V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136876
Gene: ENSMUSG00000031478
AA Change: G443V

DomainStartEndE-ValueType
S_TKc 4 259 1.11e-89 SMART
Blast:S_TKc 267 446 1e-48 BLAST
low complexity region 473 487 N/A INTRINSIC
low complexity region 497 508 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000209656
Predicted Effect probably benign
Transcript: ENSMUST00000210824
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the NimA (never in mitosis A) family of serine/threonine protein kinases. The encoded protein differs from other NimA family members in that it is not cell cycle regulated and is found primarily in the cytoplasm. The kinase is activated by prolactin stimulation, leading to phosphorylation of VAV2 guanine nucleotide exchange factor, paxillin, and activation of the RAC1 GTPase. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Mar 2009]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl4 A G 3: 151,500,118 M156V probably benign Het
Aire A T 10: 78,030,255 F546I probably damaging Het
Ankk1 T C 9: 49,420,020 E230G probably benign Het
Anp32a A T 9: 62,372,115 K86N possibly damaging Het
Aqp4 T C 18: 15,399,896 I47V possibly damaging Het
Arap3 A G 18: 37,979,863 V1098A possibly damaging Het
Ascc3 T A 10: 50,749,062 W1652R probably damaging Het
Atad2 T A 15: 58,106,813 H464L probably damaging Het
Brca2 C A 5: 150,540,208 H1146N possibly damaging Het
Capn9 G A 8: 124,597,569 V203M probably damaging Het
Ccr6 T A 17: 8,256,049 S29T probably benign Het
Cfap99 G T 5: 34,310,217 probably null Het
Cpt1c C T 7: 44,959,918 G716S probably damaging Het
Dhx29 A T 13: 112,952,861 Q722L probably benign Het
Dmxl1 C T 18: 49,852,288 R201* probably null Het
Dsg2 G A 18: 20,601,802 G946S probably damaging Het
Erg C A 16: 95,368,651 probably null Het
Fam198b G T 3: 79,886,141 probably benign Het
Fbxo32 G A 15: 58,214,641 probably benign Het
Glis1 T G 4: 107,435,879 D66E probably damaging Het
Gm21671 A G 5: 25,950,845 I167T probably benign Het
Grm6 A T 11: 50,859,825 N605I probably damaging Het
Gtf3c6 T C 10: 40,249,672 E183G probably benign Het
Herc1 A G 9: 66,397,898 M861V probably benign Het
Igkv12-41 A T 6: 69,858,529 S80T probably damaging Het
Kcnt2 T C 1: 140,596,004 S1057P probably damaging Het
Krt36 T G 11: 100,103,390 Q287P probably damaging Het
Ldhd A G 8: 111,630,274 S13P probably benign Het
Lmtk3 T A 7: 45,794,297 probably benign Het
Lrp2 A T 2: 69,513,268 F916I probably damaging Het
Map4k1 A T 7: 28,986,834 I92F probably damaging Het
Naa25 A T 5: 121,438,804 K872M probably damaging Het
Noxred1 T C 12: 87,227,036 E77G probably benign Het
Nup210 G A 6: 91,087,913 Q202* probably null Het
Olfr1065 G T 2: 86,445,907 S25Y probably benign Het
Olfr646 A T 7: 104,106,791 M171L probably benign Het
Pax3 A G 1: 78,132,419 S201P probably damaging Het
Pcdhgb5 T A 18: 37,733,404 Y751N probably benign Het
Pign A T 1: 105,553,895 L792* probably null Het
Pkd1 T C 17: 24,573,493 F1385L probably benign Het
Plxnb2 A C 15: 89,164,320 C629G probably benign Het
Prpsap2 A T 11: 61,730,271 I328N probably benign Het
Prrc2c A G 1: 162,682,371 L2317P probably damaging Het
Ptgfrn T C 3: 101,045,446 D824G probably damaging Het
Ptpra G A 2: 130,519,381 S204N probably damaging Het
Pygm G T 19: 6,393,757 G583C probably damaging Het
Rap1a A G 3: 105,732,068 F92L probably damaging Het
Slmap A T 14: 26,430,092 probably null Het
Spdye4c A G 2: 128,596,130 probably null Het
Ssfa2 C T 2: 79,657,705 R711C probably damaging Het
Stk11 C A 10: 80,128,090 F97L probably benign Het
Tbc1d9b G A 11: 50,168,746 A992T probably benign Het
Tmem232 G A 17: 65,450,310 T296M possibly damaging Het
Trim33 C T 3: 103,352,049 T1018M probably damaging Het
Trpv2 A C 11: 62,584,615 I285L probably benign Het
Usp46 A G 5: 74,028,934 probably benign Het
Vmn1r27 T A 6: 58,215,447 M191L possibly damaging Het
Vwf G T 6: 125,642,150 E1264* probably null Het
Zfp109 A T 7: 24,229,398 N195K probably benign Het
Zfp385b T A 2: 77,415,794 L208F probably damaging Het
Zfp839 T A 12: 110,866,761 Y515* probably null Het
Other mutations in Nek3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00569:Nek3 APN 8 22158706 missense probably damaging 1.00
IGL01561:Nek3 APN 8 22129456 missense probably damaging 0.97
IGL02799:Nek3 APN 8 22158719 splice site probably benign
IGL02826:Nek3 APN 8 22160368 critical splice donor site probably null
R0001:Nek3 UTSW 8 22158612 splice site probably benign
R0390:Nek3 UTSW 8 22128729 unclassified probably benign
R1367:Nek3 UTSW 8 22160361 splice site probably benign
R1565:Nek3 UTSW 8 22132201 critical splice acceptor site probably null
R1758:Nek3 UTSW 8 22160262 missense probably damaging 1.00
R1924:Nek3 UTSW 8 22157031 missense probably damaging 1.00
R3905:Nek3 UTSW 8 22133091 missense probably benign 0.01
R4078:Nek3 UTSW 8 22132137 missense probably damaging 1.00
R4089:Nek3 UTSW 8 22149913 missense probably damaging 1.00
R4621:Nek3 UTSW 8 22157039 missense probably damaging 1.00
R5207:Nek3 UTSW 8 22132227 intron probably benign
R5432:Nek3 UTSW 8 22148732 intron probably null
R5790:Nek3 UTSW 8 22131297 missense probably damaging 1.00
R5790:Nek3 UTSW 8 22131298 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAATTATTGCAGTATGGTATGGCG -3'
(R):5'- ACCCTCTTGGAGACAGAGTTG -3'

Sequencing Primer
(F):5'- CGTGTATTCCATTCCCCAATGAAAG -3'
(R):5'- TGTCTACCCAAATTATGCCGAG -3'
Posted On2018-09-12