Incidental Mutation 'R6856:Atad2'
ID535278
Institutional Source Beutler Lab
Gene Symbol Atad2
Ensembl Gene ENSMUSG00000022360
Gene NameATPase family, AAA domain containing 2
Synonyms2610509G12Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.456) question?
Stock #R6856 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location58094044-58135082 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 58106813 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 464 (H464L)
Ref Sequence ENSEMBL: ENSMUSP00000153936 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038194] [ENSMUST00000228783]
Predicted Effect probably damaging
Transcript: ENSMUST00000038194
AA Change: H788L

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000043691
Gene: ENSMUSG00000022360
AA Change: H788L

DomainStartEndE-ValueType
low complexity region 12 35 N/A INTRINSIC
low complexity region 36 47 N/A INTRINSIC
low complexity region 184 199 N/A INTRINSIC
low complexity region 237 268 N/A INTRINSIC
low complexity region 337 349 N/A INTRINSIC
AAA 438 579 9.93e-21 SMART
low complexity region 622 633 N/A INTRINSIC
SCOP:d1e32a2 751 912 5e-4 SMART
low complexity region 924 947 N/A INTRINSIC
BROMO 955 1067 1.2e-19 SMART
low complexity region 1213 1235 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000228783
AA Change: H464L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] A large family of ATPases has been described, whose key feature is that they share a conserved region of about 220 amino acids that contains an ATP-binding site. The proteins that belong to this family either contain one or two AAA (ATPases Associated with diverse cellular Activities) domains. AAA family proteins often perform chaperone-like functions that assist in the assembly, operation, or disassembly of protein complexes. The protein encoded by this gene contains two AAA domains, as well as a bromodomain. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl4 A G 3: 151,500,118 M156V probably benign Het
Aire A T 10: 78,030,255 F546I probably damaging Het
Ankk1 T C 9: 49,420,020 E230G probably benign Het
Anp32a A T 9: 62,372,115 K86N possibly damaging Het
Aqp4 T C 18: 15,399,896 I47V possibly damaging Het
Arap3 A G 18: 37,979,863 V1098A possibly damaging Het
Ascc3 T A 10: 50,749,062 W1652R probably damaging Het
Brca2 C A 5: 150,540,208 H1146N possibly damaging Het
Capn9 G A 8: 124,597,569 V203M probably damaging Het
Ccr6 T A 17: 8,256,049 S29T probably benign Het
Cfap99 G T 5: 34,310,217 probably null Het
Cpt1c C T 7: 44,959,918 G716S probably damaging Het
Dhx29 A T 13: 112,952,861 Q722L probably benign Het
Dmxl1 C T 18: 49,852,288 R201* probably null Het
Dsg2 G A 18: 20,601,802 G946S probably damaging Het
Erg C A 16: 95,368,651 probably null Het
Fam198b G T 3: 79,886,141 probably benign Het
Fbxo32 G A 15: 58,214,641 probably benign Het
Glis1 T G 4: 107,435,879 D66E probably damaging Het
Gm21671 A G 5: 25,950,845 I167T probably benign Het
Grm6 A T 11: 50,859,825 N605I probably damaging Het
Gtf3c6 T C 10: 40,249,672 E183G probably benign Het
Herc1 A G 9: 66,397,898 M861V probably benign Het
Igkv12-41 A T 6: 69,858,529 S80T probably damaging Het
Kcnt2 T C 1: 140,596,004 S1057P probably damaging Het
Krt36 T G 11: 100,103,390 Q287P probably damaging Het
Ldhd A G 8: 111,630,274 S13P probably benign Het
Lmtk3 T A 7: 45,794,297 probably benign Het
Lrp2 A T 2: 69,513,268 F916I probably damaging Het
Map4k1 A T 7: 28,986,834 I92F probably damaging Het
Naa25 A T 5: 121,438,804 K872M probably damaging Het
Nek3 C A 8: 22,129,447 G443V probably damaging Het
Noxred1 T C 12: 87,227,036 E77G probably benign Het
Nup210 G A 6: 91,087,913 Q202* probably null Het
Olfr1065 G T 2: 86,445,907 S25Y probably benign Het
Olfr646 A T 7: 104,106,791 M171L probably benign Het
Pax3 A G 1: 78,132,419 S201P probably damaging Het
Pcdhgb5 T A 18: 37,733,404 Y751N probably benign Het
Pign A T 1: 105,553,895 L792* probably null Het
Pkd1 T C 17: 24,573,493 F1385L probably benign Het
Plxnb2 A C 15: 89,164,320 C629G probably benign Het
Prpsap2 A T 11: 61,730,271 I328N probably benign Het
Prrc2c A G 1: 162,682,371 L2317P probably damaging Het
Ptgfrn T C 3: 101,045,446 D824G probably damaging Het
Ptpra G A 2: 130,519,381 S204N probably damaging Het
Pygm G T 19: 6,393,757 G583C probably damaging Het
Rap1a A G 3: 105,732,068 F92L probably damaging Het
Slmap A T 14: 26,430,092 probably null Het
Spdye4c A G 2: 128,596,130 probably null Het
Ssfa2 C T 2: 79,657,705 R711C probably damaging Het
Stk11 C A 10: 80,128,090 F97L probably benign Het
Tbc1d9b G A 11: 50,168,746 A992T probably benign Het
Tmem232 G A 17: 65,450,310 T296M possibly damaging Het
Trim33 C T 3: 103,352,049 T1018M probably damaging Het
Trpv2 A C 11: 62,584,615 I285L probably benign Het
Usp46 A G 5: 74,028,934 probably benign Het
Vmn1r27 T A 6: 58,215,447 M191L possibly damaging Het
Vwf G T 6: 125,642,150 E1264* probably null Het
Zfp109 A T 7: 24,229,398 N195K probably benign Het
Zfp385b T A 2: 77,415,794 L208F probably damaging Het
Zfp839 T A 12: 110,866,761 Y515* probably null Het
Other mutations in Atad2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:Atad2 APN 15 58116820 missense probably damaging 1.00
IGL00556:Atad2 APN 15 58100080 missense probably damaging 1.00
IGL00674:Atad2 APN 15 58108386 missense possibly damaging 0.49
IGL01407:Atad2 APN 15 58104525 missense probably benign
IGL02557:Atad2 APN 15 58122597 missense probably benign 0.04
IGL03060:Atad2 APN 15 58122446 unclassified probably benign
IGL03308:Atad2 APN 15 58102523 missense probably benign 0.00
R0113:Atad2 UTSW 15 58120934 unclassified probably benign
R0195:Atad2 UTSW 15 58099954 splice site probably benign
R0310:Atad2 UTSW 15 58114257 missense probably damaging 1.00
R0499:Atad2 UTSW 15 58103240 missense possibly damaging 0.92
R0499:Atad2 UTSW 15 58120949 missense probably benign
R0564:Atad2 UTSW 15 58125833 splice site probably benign
R0578:Atad2 UTSW 15 58105568 missense probably damaging 1.00
R0581:Atad2 UTSW 15 58126664 missense probably benign
R0667:Atad2 UTSW 15 58098719 missense probably benign 0.01
R0697:Atad2 UTSW 15 58105543 missense possibly damaging 0.91
R1219:Atad2 UTSW 15 58134911 missense probably benign 0.00
R1271:Atad2 UTSW 15 58126589 missense probably benign 0.00
R1544:Atad2 UTSW 15 58103364 missense probably damaging 1.00
R1624:Atad2 UTSW 15 58100019 missense probably damaging 1.00
R1853:Atad2 UTSW 15 58097289 missense possibly damaging 0.56
R1854:Atad2 UTSW 15 58097289 missense possibly damaging 0.56
R1855:Atad2 UTSW 15 58097289 missense possibly damaging 0.56
R1860:Atad2 UTSW 15 58096718 splice site probably null
R1861:Atad2 UTSW 15 58096718 splice site probably null
R1876:Atad2 UTSW 15 58106868 missense probably benign 0.00
R1938:Atad2 UTSW 15 58096705 missense possibly damaging 0.76
R2158:Atad2 UTSW 15 58098566 missense possibly damaging 0.95
R3756:Atad2 UTSW 15 58099723 missense probably benign 0.01
R4256:Atad2 UTSW 15 58116856 missense probably damaging 1.00
R4762:Atad2 UTSW 15 58108362 missense probably benign
R4827:Atad2 UTSW 15 58108348 missense probably benign 0.07
R4838:Atad2 UTSW 15 58103283 missense probably damaging 1.00
R5238:Atad2 UTSW 15 58108337 missense possibly damaging 0.90
R5247:Atad2 UTSW 15 58104478 nonsense probably null
R5685:Atad2 UTSW 15 58116798 missense possibly damaging 0.95
R5790:Atad2 UTSW 15 58126594 missense probably damaging 1.00
R5813:Atad2 UTSW 15 58099854 missense probably benign 0.42
R5886:Atad2 UTSW 15 58098514 nonsense probably null
R5955:Atad2 UTSW 15 58105659 missense probably benign 0.06
R6034:Atad2 UTSW 15 58108563 missense probably damaging 1.00
R6034:Atad2 UTSW 15 58108563 missense probably damaging 1.00
R6111:Atad2 UTSW 15 58108091 missense probably benign 0.07
R6209:Atad2 UTSW 15 58118415 missense probably damaging 1.00
R6587:Atad2 UTSW 15 58121048 missense probably benign 0.03
R7106:Atad2 UTSW 15 58116766 critical splice donor site probably null
R7178:Atad2 UTSW 15 58117293 missense probably damaging 1.00
R7290:Atad2 UTSW 15 58098651 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCCAAGTTTGCTGGGCATGG -3'
(R):5'- GCTAGTCGTATAGGTAAGACTTGTG -3'

Sequencing Primer
(F):5'- CTGAGAGTTTGAGGCCAACTCTAC -3'
(R):5'- GACTTGTGAAGATTTGTAATTAGCG -3'
Posted On2018-09-12