Incidental Mutation 'R6856:Dsg2'
ID535286
Institutional Source Beutler Lab
Gene Symbol Dsg2
Ensembl Gene ENSMUSG00000044393
Gene Namedesmoglein 2
SynonymsD18Ertd293e
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.197) question?
Stock #R6856 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location20558074-20604521 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 20601802 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 946 (G946S)
Ref Sequence ENSEMBL: ENSMUSP00000057096 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059787]
Predicted Effect probably damaging
Transcript: ENSMUST00000059787
AA Change: G946S

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000057096
Gene: ENSMUSG00000044393
AA Change: G946S

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 75 162 2.39e-8 SMART
CA 186 275 5.17e-27 SMART
CA 298 392 1.94e-8 SMART
CA 418 502 2.34e-16 SMART
transmembrane domain 618 640 N/A INTRINSIC
low complexity region 822 838 N/A INTRINSIC
low complexity region 914 928 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of proteins that forms an integral transmembrane component of desmosomes, the multiprotein complexes involved in cell adhesion, organization of the cytoskeleton, cell sorting and cell signaling. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Mice lacking the encoded protein die in utero. Mutant mice lacking a part of the extracellular adhesive domain of the encoded protein develop cardiac fibrosis and dilation. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality before somite formation, impaired cell proliferation, and increased apoptosis. Heterozygous mutation of this gene also results in embryonic lethality before somite formation with partial penetrance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl4 A G 3: 151,500,118 M156V probably benign Het
Aire A T 10: 78,030,255 F546I probably damaging Het
Ankk1 T C 9: 49,420,020 E230G probably benign Het
Anp32a A T 9: 62,372,115 K86N possibly damaging Het
Aqp4 T C 18: 15,399,896 I47V possibly damaging Het
Arap3 A G 18: 37,979,863 V1098A possibly damaging Het
Ascc3 T A 10: 50,749,062 W1652R probably damaging Het
Atad2 T A 15: 58,106,813 H464L probably damaging Het
Brca2 C A 5: 150,540,208 H1146N possibly damaging Het
Capn9 G A 8: 124,597,569 V203M probably damaging Het
Ccr6 T A 17: 8,256,049 S29T probably benign Het
Cfap99 G T 5: 34,310,217 probably null Het
Cpt1c C T 7: 44,959,918 G716S probably damaging Het
Dhx29 A T 13: 112,952,861 Q722L probably benign Het
Dmxl1 C T 18: 49,852,288 R201* probably null Het
Erg C A 16: 95,368,651 probably null Het
Fam198b G T 3: 79,886,141 probably benign Het
Fbxo32 G A 15: 58,214,641 probably benign Het
Glis1 T G 4: 107,435,879 D66E probably damaging Het
Gm21671 A G 5: 25,950,845 I167T probably benign Het
Grm6 A T 11: 50,859,825 N605I probably damaging Het
Gtf3c6 T C 10: 40,249,672 E183G probably benign Het
Herc1 A G 9: 66,397,898 M861V probably benign Het
Igkv12-41 A T 6: 69,858,529 S80T probably damaging Het
Kcnt2 T C 1: 140,596,004 S1057P probably damaging Het
Krt36 T G 11: 100,103,390 Q287P probably damaging Het
Ldhd A G 8: 111,630,274 S13P probably benign Het
Lmtk3 T A 7: 45,794,297 probably benign Het
Lrp2 A T 2: 69,513,268 F916I probably damaging Het
Map4k1 A T 7: 28,986,834 I92F probably damaging Het
Naa25 A T 5: 121,438,804 K872M probably damaging Het
Nek3 C A 8: 22,129,447 G443V probably damaging Het
Noxred1 T C 12: 87,227,036 E77G probably benign Het
Nup210 G A 6: 91,087,913 Q202* probably null Het
Olfr1065 G T 2: 86,445,907 S25Y probably benign Het
Olfr646 A T 7: 104,106,791 M171L probably benign Het
Pax3 A G 1: 78,132,419 S201P probably damaging Het
Pcdhgb5 T A 18: 37,733,404 Y751N probably benign Het
Pign A T 1: 105,553,895 L792* probably null Het
Pkd1 T C 17: 24,573,493 F1385L probably benign Het
Plxnb2 A C 15: 89,164,320 C629G probably benign Het
Prpsap2 A T 11: 61,730,271 I328N probably benign Het
Prrc2c A G 1: 162,682,371 L2317P probably damaging Het
Ptgfrn T C 3: 101,045,446 D824G probably damaging Het
Ptpra G A 2: 130,519,381 S204N probably damaging Het
Pygm G T 19: 6,393,757 G583C probably damaging Het
Rap1a A G 3: 105,732,068 F92L probably damaging Het
Slmap A T 14: 26,430,092 probably null Het
Spdye4c A G 2: 128,596,130 probably null Het
Ssfa2 C T 2: 79,657,705 R711C probably damaging Het
Stk11 C A 10: 80,128,090 F97L probably benign Het
Tbc1d9b G A 11: 50,168,746 A992T probably benign Het
Tmem232 G A 17: 65,450,310 T296M possibly damaging Het
Trim33 C T 3: 103,352,049 T1018M probably damaging Het
Trpv2 A C 11: 62,584,615 I285L probably benign Het
Usp46 A G 5: 74,028,934 probably benign Het
Vmn1r27 T A 6: 58,215,447 M191L possibly damaging Het
Vwf G T 6: 125,642,150 E1264* probably null Het
Zfp109 A T 7: 24,229,398 N195K probably benign Het
Zfp385b T A 2: 77,415,794 L208F probably damaging Het
Zfp839 T A 12: 110,866,761 Y515* probably null Het
Other mutations in Dsg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Dsg2 APN 18 20601769 missense probably benign 0.10
IGL00979:Dsg2 APN 18 20582767 missense probably damaging 0.99
IGL01081:Dsg2 APN 18 20589942 unclassified probably benign
IGL01358:Dsg2 APN 18 20601793 missense probably damaging 0.98
IGL02002:Dsg2 APN 18 20579176 missense probably damaging 1.00
IGL02263:Dsg2 APN 18 20590020 missense possibly damaging 0.70
IGL02410:Dsg2 APN 18 20602132 missense probably benign 0.04
IGL02553:Dsg2 APN 18 20592410 missense probably damaging 1.00
IGL03036:Dsg2 APN 18 20579077 missense probably damaging 0.99
dissolute UTSW 18 20595951 splice site probably null
Dysjunction UTSW 18 20582939 nonsense probably null
weg UTSW 18 20580651 nonsense probably null
R0094:Dsg2 UTSW 18 20591853 missense probably benign 0.08
R0094:Dsg2 UTSW 18 20591853 missense probably benign 0.08
R0105:Dsg2 UTSW 18 20602054 missense probably benign 0.03
R0105:Dsg2 UTSW 18 20602054 missense probably benign 0.03
R0112:Dsg2 UTSW 18 20583042 missense probably benign 0.02
R0305:Dsg2 UTSW 18 20582695 splice site probably benign
R0380:Dsg2 UTSW 18 20582939 nonsense probably null
R0401:Dsg2 UTSW 18 20592508 splice site probably benign
R0421:Dsg2 UTSW 18 20579391 missense probably damaging 1.00
R0578:Dsg2 UTSW 18 20594234 missense probably benign 0.00
R0667:Dsg2 UTSW 18 20573499 missense possibly damaging 0.50
R1223:Dsg2 UTSW 18 20573493 missense probably benign 0.23
R1433:Dsg2 UTSW 18 20582723 missense probably damaging 0.98
R1543:Dsg2 UTSW 18 20594211 missense probably benign 0.33
R1730:Dsg2 UTSW 18 20591880 missense probably benign 0.01
R1783:Dsg2 UTSW 18 20591880 missense probably benign 0.01
R1946:Dsg2 UTSW 18 20580548 missense probably damaging 1.00
R1991:Dsg2 UTSW 18 20601473 missense probably damaging 1.00
R1992:Dsg2 UTSW 18 20601473 missense probably damaging 1.00
R2027:Dsg2 UTSW 18 20583004 unclassified probably null
R2109:Dsg2 UTSW 18 20592289 missense probably benign 0.00
R2143:Dsg2 UTSW 18 20579161 missense probably damaging 1.00
R2201:Dsg2 UTSW 18 20596054 missense probably damaging 1.00
R2343:Dsg2 UTSW 18 20602298 missense probably damaging 0.99
R2937:Dsg2 UTSW 18 20579128 missense probably damaging 1.00
R3710:Dsg2 UTSW 18 20602117 missense probably damaging 1.00
R3734:Dsg2 UTSW 18 20601947 missense probably benign 0.41
R3773:Dsg2 UTSW 18 20591862 missense probably damaging 1.00
R4176:Dsg2 UTSW 18 20580663 missense probably benign 0.25
R4213:Dsg2 UTSW 18 20598514 missense probably benign 0.01
R4299:Dsg2 UTSW 18 20595951 splice site probably null
R4515:Dsg2 UTSW 18 20601387 missense probably benign
R4649:Dsg2 UTSW 18 20602245 missense possibly damaging 0.56
R4940:Dsg2 UTSW 18 20579430 missense probably damaging 1.00
R4949:Dsg2 UTSW 18 20590184 missense probably damaging 1.00
R4998:Dsg2 UTSW 18 20601521 missense probably benign 0.26
R5078:Dsg2 UTSW 18 20596083 critical splice donor site probably null
R5155:Dsg2 UTSW 18 20598658 missense possibly damaging 0.67
R5398:Dsg2 UTSW 18 20579133 missense probably benign 0.45
R5503:Dsg2 UTSW 18 20580651 nonsense probably null
R6133:Dsg2 UTSW 18 20590089 missense probably benign 0.00
R6163:Dsg2 UTSW 18 20598669 critical splice donor site probably null
R6226:Dsg2 UTSW 18 20579449 missense probably damaging 0.98
R6228:Dsg2 UTSW 18 20594293 critical splice donor site probably null
R6241:Dsg2 UTSW 18 20590217 splice site probably null
R6482:Dsg2 UTSW 18 20601314 missense possibly damaging 0.69
R6524:Dsg2 UTSW 18 20583036 missense probably damaging 1.00
R7058:Dsg2 UTSW 18 20592275 missense probably benign 0.00
R7108:Dsg2 UTSW 18 20601863 missense probably damaging 1.00
R7149:Dsg2 UTSW 18 20579454 missense probably damaging 0.98
R7207:Dsg2 UTSW 18 20601459 missense probably damaging 0.99
R7256:Dsg2 UTSW 18 20591931 missense possibly damaging 0.96
R7315:Dsg2 UTSW 18 20579160 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AGAGCGCGTACTCCTCTAAC -3'
(R):5'- CCATTACATACTGTGCATCTTTCAG -3'

Sequencing Primer
(F):5'- GCGTACTCCTCTAACACCGG -3'
(R):5'- TGACCTCAAGGGGCTTAGG -3'
Posted On2018-09-12