Incidental Mutation 'R6857:B020011L13Rik'
ID535293
Institutional Source Beutler Lab
Gene Symbol B020011L13Rik
Ensembl Gene ENSMUSG00000101303
Gene NameRIKEN cDNA B020011L13 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.461) question?
Stock #R6857 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location117781133-117803359 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 117801288 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 175 (H175L)
Ref Sequence ENSEMBL: ENSMUSP00000140211 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000188801]
Predicted Effect probably benign
Transcript: ENSMUST00000188801
AA Change: H175L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000140211
Gene: ENSMUSG00000101303
AA Change: H175L

DomainStartEndE-ValueType
KRAB 8 66 6.9e-26 SMART
ZnF_C2H2 77 99 8.3e-6 SMART
ZnF_C2H2 105 127 1.8e-5 SMART
ZnF_C2H2 133 155 8.7e-4 SMART
ZnF_C2H2 161 183 2.1e-4 SMART
ZnF_C2H2 189 211 1.1e-7 SMART
ZnF_C2H2 217 239 4e-5 SMART
ZnF_C2H2 245 267 1.6e-7 SMART
ZnF_C2H2 273 295 5.4e-7 SMART
ZnF_C2H2 301 323 5.1e-4 SMART
ZnF_C2H2 329 351 1.1e-1 SMART
ZnF_C2H2 357 379 3.4e-6 SMART
ZnF_C2H2 385 407 3.2e-7 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (58/58)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410141K09Rik A T 13: 66,432,102 H107Q probably benign Het
Abca6 A G 11: 110,219,688 L545P possibly damaging Het
Adam4 T C 12: 81,419,949 T633A possibly damaging Het
Ahnak C T 19: 9,037,168 Q119* probably null Het
AI314180 T A 4: 58,814,065 D1347V probably damaging Het
Anxa10 C A 8: 62,061,017 A239S probably benign Het
BC067074 A T 13: 113,319,958 N846I probably damaging Het
Best2 A G 8: 85,007,823 V422A probably benign Het
Cc2d2b T C 19: 40,770,865 F298S possibly damaging Het
Cd38 T A 5: 43,906,198 M211K probably damaging Het
Cd3d T G 9: 44,985,604 M92R probably damaging Het
Cdk5rap2 C A 4: 70,245,396 E1474* probably null Het
Clvs1 A G 4: 9,449,433 K341E probably benign Het
Copg2 G T 6: 30,863,598 D112E possibly damaging Het
Dmxl1 A T 18: 49,864,835 N697Y probably damaging Het
Dync1h1 T C 12: 110,658,547 S3803P possibly damaging Het
Epx T A 11: 87,869,955 K384* probably null Het
Fam135a G C 1: 24,014,789 D1222E probably damaging Het
Fndc1 T A 17: 7,772,170 H898L unknown Het
Gapvd1 A G 2: 34,728,377 I190T probably damaging Het
Gm14139 G T 2: 150,192,062 C132F probably damaging Het
Hax1 T G 3: 89,997,452 S122R probably damaging Het
Hdac9 T G 12: 34,393,363 M272L probably benign Het
Itgb7 T C 15: 102,223,465 S228G probably damaging Het
Itpr2 C A 6: 146,397,019 E315* probably null Het
Kctd8 T C 5: 69,296,702 N331D probably benign Het
Ky G A 9: 102,542,432 G546E probably damaging Het
Lao1 T C 4: 118,963,826 probably null Het
Mtmr12 T A 15: 12,263,832 W427R probably damaging Het
Mxra8 A G 4: 155,843,136 K434E possibly damaging Het
Myh4 T C 11: 67,249,885 C676R possibly damaging Het
Nek7 C T 1: 138,515,682 G178R probably damaging Het
Olfr1082 A T 2: 86,594,264 L188H probably damaging Het
Olfr1141 A T 2: 87,753,487 C169S probably damaging Het
Olfr914 T C 9: 38,607,011 L182P probably benign Het
Paqr5 G T 9: 61,976,088 H41N probably damaging Het
Plekha8 T C 6: 54,629,935 L405P probably damaging Het
Plpbp A G 8: 27,045,426 N79S possibly damaging Het
Plxnd1 G T 6: 115,993,763 A348E probably benign Het
Prdm9 T C 17: 15,544,256 Q754R probably benign Het
Pygm G T 19: 6,393,757 G583C probably damaging Het
Rgs12 A T 5: 35,030,022 K213* probably null Het
Serpina3m T C 12: 104,389,326 L84P probably damaging Het
Tab2 T C 10: 7,920,413 T102A possibly damaging Het
Tagln3 G T 16: 45,724,236 A24E probably benign Het
Tanc2 A G 11: 105,910,288 E1110G possibly damaging Het
Tcf3 T C 10: 80,416,899 probably null Het
Tmem14a T C 1: 21,229,545 probably benign Het
Ttn T A 2: 76,917,931 E4258V possibly damaging Het
Ubr4 G A 4: 139,486,051 D5104N possibly damaging Het
Ugt2b37 C G 5: 87,240,846 A503P probably damaging Het
Unc45b A G 11: 82,913,212 I72V probably benign Het
Vmn1r88 A T 7: 13,178,331 M205L possibly damaging Het
Vmn2r109 C T 17: 20,540,670 M808I probably benign Het
Wdr72 G T 9: 74,155,041 V490L probably damaging Het
Zgrf1 T A 3: 127,581,447 V785E probably damaging Het
Zswim7 A T 11: 62,281,129 probably benign Het
Other mutations in B020011L13Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03058:B020011L13Rik APN 1 117782969 missense possibly damaging 0.77
R6340:B020011L13Rik UTSW 1 117801884 missense probably benign 0.00
R6785:B020011L13Rik UTSW 1 117801069 missense possibly damaging 0.78
R7027:B020011L13Rik UTSW 1 117801450 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- CACTGCAGACTTTCTACTCACG -3'
(R):5'- GGATTCTCTGGTGAACTTTAAGATCTG -3'

Sequencing Primer
(F):5'- GTTCACCAGAGATTACATACTGGAG -3'
(R):5'- CTGTGCAAAAGATTTTCCACATTC -3'
Posted On2018-09-12