Incidental Mutation 'R6857:2410141K09Rik'
ID535335
Institutional Source Beutler Lab
Gene Symbol 2410141K09Rik
Ensembl Gene ENSMUSG00000074832
Gene NameRIKEN cDNA 2410141K09 gene
SynonymsGt(Ayu21)35Imeg, Gt(pU21)35Imeg
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.238) question?
Stock #R6857 (G1)
Quality Score89.0077
Status Validated
Chromosome13
Chromosomal Location66418114-66441118 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 66432102 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 107 (H107Q)
Ref Sequence ENSEMBL: ENSMUSP00000134352 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091541] [ENSMUST00000172579] [ENSMUST00000173583]
Predicted Effect probably benign
Transcript: ENSMUST00000091541
SMART Domains Protein: ENSMUSP00000089126
Gene: ENSMUSG00000074832

DomainStartEndE-ValueType
KRAB 4 66 6.16e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172579
AA Change: H107Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000134352
Gene: ENSMUSG00000074832
AA Change: H107Q

DomainStartEndE-ValueType
KRAB 4 66 3.3e-15 SMART
ZnF_C2H2 75 97 1.72e-4 SMART
ZnF_C2H2 103 125 1.06e-4 SMART
ZnF_C2H2 131 153 5.81e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173583
SMART Domains Protein: ENSMUSP00000134048
Gene: ENSMUSG00000074832

DomainStartEndE-ValueType
KRAB 4 66 6.16e-15 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (58/58)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A G 11: 110,219,688 L545P possibly damaging Het
Adam4 T C 12: 81,419,949 T633A possibly damaging Het
Ahnak C T 19: 9,037,168 Q119* probably null Het
AI314180 T A 4: 58,814,065 D1347V probably damaging Het
Anxa10 C A 8: 62,061,017 A239S probably benign Het
B020011L13Rik A T 1: 117,801,288 H175L probably benign Het
BC067074 A T 13: 113,319,958 N846I probably damaging Het
Best2 A G 8: 85,007,823 V422A probably benign Het
Cc2d2b T C 19: 40,770,865 F298S possibly damaging Het
Cd38 T A 5: 43,906,198 M211K probably damaging Het
Cd3d T G 9: 44,985,604 M92R probably damaging Het
Cdk5rap2 C A 4: 70,245,396 E1474* probably null Het
Clvs1 A G 4: 9,449,433 K341E probably benign Het
Copg2 G T 6: 30,863,598 D112E possibly damaging Het
Dmxl1 A T 18: 49,864,835 N697Y probably damaging Het
Dync1h1 T C 12: 110,658,547 S3803P possibly damaging Het
Epx T A 11: 87,869,955 K384* probably null Het
Fam135a G C 1: 24,014,789 D1222E probably damaging Het
Fndc1 T A 17: 7,772,170 H898L unknown Het
Gapvd1 A G 2: 34,728,377 I190T probably damaging Het
Gm14139 G T 2: 150,192,062 C132F probably damaging Het
Hax1 T G 3: 89,997,452 S122R probably damaging Het
Hdac9 T G 12: 34,393,363 M272L probably benign Het
Itgb7 T C 15: 102,223,465 S228G probably damaging Het
Itpr2 C A 6: 146,397,019 E315* probably null Het
Kctd8 T C 5: 69,296,702 N331D probably benign Het
Ky G A 9: 102,542,432 G546E probably damaging Het
Lao1 T C 4: 118,963,826 probably null Het
Mtmr12 T A 15: 12,263,832 W427R probably damaging Het
Mxra8 A G 4: 155,843,136 K434E possibly damaging Het
Myh4 T C 11: 67,249,885 C676R possibly damaging Het
Nek7 C T 1: 138,515,682 G178R probably damaging Het
Olfr1082 A T 2: 86,594,264 L188H probably damaging Het
Olfr1141 A T 2: 87,753,487 C169S probably damaging Het
Olfr914 T C 9: 38,607,011 L182P probably benign Het
Paqr5 G T 9: 61,976,088 H41N probably damaging Het
Plekha8 T C 6: 54,629,935 L405P probably damaging Het
Plpbp A G 8: 27,045,426 N79S possibly damaging Het
Plxnd1 G T 6: 115,993,763 A348E probably benign Het
Prdm9 T C 17: 15,544,256 Q754R probably benign Het
Pygm G T 19: 6,393,757 G583C probably damaging Het
Rgs12 A T 5: 35,030,022 K213* probably null Het
Serpina3m T C 12: 104,389,326 L84P probably damaging Het
Tab2 T C 10: 7,920,413 T102A possibly damaging Het
Tagln3 G T 16: 45,724,236 A24E probably benign Het
Tanc2 A G 11: 105,910,288 E1110G possibly damaging Het
Tcf3 T C 10: 80,416,899 probably null Het
Tmem14a T C 1: 21,229,545 probably benign Het
Ttn T A 2: 76,917,931 E4258V possibly damaging Het
Ubr4 G A 4: 139,486,051 D5104N possibly damaging Het
Ugt2b37 C G 5: 87,240,846 A503P probably damaging Het
Unc45b A G 11: 82,913,212 I72V probably benign Het
Vmn1r88 A T 7: 13,178,331 M205L possibly damaging Het
Vmn2r109 C T 17: 20,540,670 M808I probably benign Het
Wdr72 G T 9: 74,155,041 V490L probably damaging Het
Zgrf1 T A 3: 127,581,447 V785E probably damaging Het
Zswim7 A T 11: 62,281,129 probably benign Het
Other mutations in 2410141K09Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R2698:2410141K09Rik UTSW 13 66433434 missense probably damaging 0.99
R2881:2410141K09Rik UTSW 13 66431270 missense probably damaging 1.00
R5217:2410141K09Rik UTSW 13 66433726 missense probably damaging 1.00
R5401:2410141K09Rik UTSW 13 66431663 missense probably benign 0.01
R5429:2410141K09Rik UTSW 13 66431828 missense probably benign 0.00
R5532:2410141K09Rik UTSW 13 66431681 missense probably damaging 1.00
R5626:2410141K09Rik UTSW 13 66431981 missense probably benign 0.00
R5686:2410141K09Rik UTSW 13 66431663 missense probably benign 0.01
R6151:2410141K09Rik UTSW 13 66431681 missense probably damaging 1.00
R6173:2410141K09Rik UTSW 13 66431549 missense probably benign 0.00
Z1088:2410141K09Rik UTSW 13 66431186 missense probably damaging 1.00
Z1088:2410141K09Rik UTSW 13 66431741 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTTGCAAAGGCTTTCCCACATT -3'
(R):5'- CTTACCATCACAGCTGTTTTCAAAG -3'

Sequencing Primer
(F):5'- GCAAAGGCTTTCCCACATTG -3'
(R):5'- CAGCTGTTTTCAAAGAGGCAAAAC -3'
Posted On2018-09-12