Incidental Mutation 'R6860:Sec16a'
ID535404
Institutional Source Beutler Lab
Gene Symbol Sec16a
Ensembl Gene ENSMUSG00000026924
Gene NameSEC16 homolog A, endoplasmic reticulum export factor
SynonymsC230052J16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.956) question?
Stock #R6860 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location26409431-26445216 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 26430112 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 1438 (Y1438C)
Ref Sequence ENSEMBL: ENSMUSP00000109716 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091252] [ENSMUST00000114082]
Predicted Effect probably damaging
Transcript: ENSMUST00000091252
AA Change: Y1438C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000088796
Gene: ENSMUSG00000026924
AA Change: Y1438C

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
low complexity region 204 221 N/A INTRINSIC
low complexity region 243 254 N/A INTRINSIC
low complexity region 371 382 N/A INTRINSIC
low complexity region 537 561 N/A INTRINSIC
low complexity region 608 621 N/A INTRINSIC
low complexity region 760 777 N/A INTRINSIC
low complexity region 1096 1105 N/A INTRINSIC
low complexity region 1134 1150 N/A INTRINSIC
low complexity region 1185 1195 N/A INTRINSIC
low complexity region 1370 1392 N/A INTRINSIC
Pfam:Sec16 1463 1565 3.1e-24 PFAM
low complexity region 1600 1614 N/A INTRINSIC
Pfam:Sec16_C 1635 1898 2.3e-39 PFAM
low complexity region 2109 2124 N/A INTRINSIC
low complexity region 2165 2177 N/A INTRINSIC
low complexity region 2187 2197 N/A INTRINSIC
low complexity region 2227 2242 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114082
AA Change: Y1438C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109716
Gene: ENSMUSG00000026924
AA Change: Y1438C

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
low complexity region 204 221 N/A INTRINSIC
low complexity region 243 254 N/A INTRINSIC
low complexity region 371 382 N/A INTRINSIC
low complexity region 537 561 N/A INTRINSIC
low complexity region 608 621 N/A INTRINSIC
low complexity region 760 777 N/A INTRINSIC
low complexity region 1096 1105 N/A INTRINSIC
low complexity region 1134 1150 N/A INTRINSIC
low complexity region 1185 1195 N/A INTRINSIC
low complexity region 1370 1392 N/A INTRINSIC
Pfam:Sec16 1464 1564 2.6e-10 PFAM
low complexity region 1600 1614 N/A INTRINSIC
Pfam:Sec16_C 1636 1887 6.8e-45 PFAM
low complexity region 2109 2124 N/A INTRINSIC
low complexity region 2165 2177 N/A INTRINSIC
low complexity region 2187 2197 N/A INTRINSIC
low complexity region 2227 2242 N/A INTRINSIC
low complexity region 2310 2320 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156442
SMART Domains Protein: ENSMUSP00000122255
Gene: ENSMUSG00000026924

DomainStartEndE-ValueType
Pfam:Sec16 14 114 7.7e-11 PFAM
low complexity region 150 164 N/A INTRINSIC
Pfam:Sec16_C 186 438 1.6e-45 PFAM
low complexity region 659 674 N/A INTRINSIC
low complexity region 715 727 N/A INTRINSIC
low complexity region 737 747 N/A INTRINSIC
low complexity region 777 792 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 100% (86/86)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that forms part of the Sec16 complex. This protein has a role in protein transport from the endoplasmic reticulum (ER) to the Golgi and mediates COPII vesicle formation at the transitional ER. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Feb 2013]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A G 11: 23,625,100 L58P probably damaging Het
4933427D14Rik T C 11: 72,189,586 E418G probably damaging Het
9930012K11Rik C A 14: 70,157,622 V28L possibly damaging Het
Abtb2 C T 2: 103,709,425 R712* probably null Het
Acvr1c C T 2: 58,287,705 G171S probably damaging Het
Ahctf1 G T 1: 179,753,288 A1783E probably benign Het
Anapc4 A T 5: 52,848,828 Q149L probably damaging Het
Ankrd27 T C 7: 35,628,527 V824A possibly damaging Het
Ankrd31 G C 13: 96,831,586 C577S probably benign Het
Apol7c T C 15: 77,526,074 N224S probably benign Het
Arl14 A T 3: 69,222,696 T59S probably benign Het
Astn1 T A 1: 158,612,472 I870K probably damaging Het
B4galt1 A T 4: 40,807,796 V335E probably benign Het
C2cd3 C T 7: 100,390,241 P216S probably benign Het
Cchcr1 C A 17: 35,529,118 N711K possibly damaging Het
Chd2 A G 7: 73,497,810 F467L possibly damaging Het
Cntn6 A T 6: 104,861,946 E987V possibly damaging Het
Col11a2 T A 17: 34,053,598 L286H probably damaging Het
Cwc22 C T 2: 77,929,448 R85Q possibly damaging Het
Cyp7a1 A C 4: 6,272,587 F209V probably damaging Het
Dmtn T C 14: 70,614,882 T189A possibly damaging Het
Dnhd1 C G 7: 105,678,266 N777K probably benign Het
Dusp16 A T 6: 134,725,879 C216* probably null Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fbn1 T C 2: 125,328,158 N1993S probably damaging Het
Fbxw22 A G 9: 109,383,962 S306P probably benign Het
Ferd3l T C 12: 33,928,652 S55P probably benign Het
Fpr-rs3 A G 17: 20,624,298 S194P possibly damaging Het
Gm19965 G A 1: 116,820,879 D97N probably benign Het
Gtpbp2 A G 17: 46,167,988 probably benign Het
Hcn3 A C 3: 89,159,845 I72S possibly damaging Het
Hist1h3f G T 13: 23,544,590 V36L probably benign Het
Hk3 T A 13: 55,014,465 N109Y probably damaging Het
Iqub T C 6: 24,505,738 E57G possibly damaging Het
Kcnk3 T A 5: 30,622,053 M149K possibly damaging Het
Kcp C T 6: 29,505,720 G51D probably benign Het
Kif26a C A 12: 112,146,829 A53D probably damaging Het
Lifr T A 15: 7,172,937 I353K probably benign Het
Llph A T 10: 120,231,284 N102I probably damaging Het
Lmo3 C A 6: 138,416,568 R18L possibly damaging Het
Lrrc46 T C 11: 97,035,545 E175G probably benign Het
Ltk A T 2: 119,754,594 C128* probably null Het
Map1b T C 13: 99,434,767 E482G probably damaging Het
Mapk8ip2 T C 15: 89,460,452 V740A probably damaging Het
Miga2 T C 2: 30,371,163 W157R probably benign Het
Mlip A G 9: 77,102,393 *837Q probably null Het
Mroh2a G T 1: 88,254,935 R1195L possibly damaging Het
Myl1 T C 1: 66,945,058 probably benign Het
Olfr365 T C 2: 37,202,177 L312P possibly damaging Het
Olfr448 T C 6: 42,896,816 Y122H probably benign Het
Olfr613 A G 7: 103,551,868 I28V probably benign Het
P3h3 A T 6: 124,857,368 V107D probably benign Het
Papolb A T 5: 142,528,896 S331T possibly damaging Het
Pars2 T G 4: 106,654,503 V494G probably benign Het
Pcdhb3 C A 18: 37,301,710 T243K probably benign Het
Pde9a T A 17: 31,470,724 M415K probably damaging Het
Ppp1r9b G A 11: 94,992,148 A201T probably benign Het
Prl A G 13: 27,064,959 N197S possibly damaging Het
Prl2c1 T A 13: 27,851,741 M32K probably benign Het
Prrt4 T C 6: 29,170,738 S572G possibly damaging Het
Psd T A 19: 46,322,419 D397V probably damaging Het
Psme2b A T 11: 48,945,480 Y213* probably null Het
Ptcd3 T A 6: 71,897,110 probably null Het
Ptprk T G 10: 28,334,484 F167L probably damaging Het
Rfx7 T C 9: 72,616,944 V472A probably damaging Het
Scnn1g T C 7: 121,740,353 L125S probably damaging Het
Serinc3 C T 2: 163,634,446 S155N probably benign Het
Slc3a2 A T 19: 8,713,632 V78E probably damaging Het
Slc44a4 T A 17: 34,921,068 L23Q probably damaging Het
Slco5a1 C T 1: 12,881,196 probably benign Het
Slit1 A G 19: 41,616,715 M899T probably benign Het
Sorl1 A G 9: 42,022,392 I1094T probably benign Het
Spag9 T A 11: 94,081,370 L258Q probably benign Het
Strip1 T C 3: 107,618,936 E488G possibly damaging Het
Stx18 G A 5: 38,104,891 D30N possibly damaging Het
Sync T C 4: 129,287,790 probably null Het
Syncrip A G 9: 88,476,796 V220A probably damaging Het
Tagln2 T C 1: 172,505,909 I110T probably benign Het
Taok1 T C 11: 77,541,801 T729A probably benign Het
Tgfbrap1 C T 1: 43,067,599 V75I possibly damaging Het
Tnfrsf21 A G 17: 43,017,066 T24A probably benign Het
Tnxb T A 17: 34,713,157 D2221E probably damaging Het
Triml1 A G 8: 43,130,566 S333P probably damaging Het
Trp53bp1 C A 2: 121,199,113 R1862L probably damaging Het
Tsc22d1 T G 14: 76,418,292 I737S possibly damaging Het
U2af2 A T 7: 5,079,274 K462N possibly damaging Het
Ubap2 A C 4: 41,233,631 N86K probably damaging Het
Uso1 A G 5: 92,195,348 K764E probably benign Het
Vmn1r192 T A 13: 22,187,952 M33L probably benign Het
Other mutations in Sec16a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Sec16a APN 2 26439487 missense probably benign 0.15
IGL00435:Sec16a APN 2 26430101 missense probably benign 0.00
IGL00469:Sec16a APN 2 26428300 missense probably damaging 1.00
IGL01622:Sec16a APN 2 26438903 missense probably benign 0.00
IGL01623:Sec16a APN 2 26438903 missense probably benign 0.00
IGL02158:Sec16a APN 2 26416632 critical splice donor site probably null
IGL02188:Sec16a APN 2 26436008 missense probably damaging 1.00
IGL02445:Sec16a APN 2 26422040 missense probably benign
IGL02568:Sec16a APN 2 26436042 missense probably damaging 1.00
IGL02710:Sec16a APN 2 26430130 missense possibly damaging 0.75
IGL02735:Sec16a APN 2 26428137 splice site probably benign
IGL02964:Sec16a APN 2 26419723 missense probably benign 0.00
IGL03027:Sec16a APN 2 26423589 missense probably benign 0.13
IGL03073:Sec16a APN 2 26439183 missense probably benign 0.02
IGL03297:Sec16a APN 2 26439190 missense probably benign 0.05
IGL03339:Sec16a APN 2 26435933 missense probably benign
H8562:Sec16a UTSW 2 26441505 missense probably benign
IGL03050:Sec16a UTSW 2 26415747 missense probably damaging 1.00
PIT4486001:Sec16a UTSW 2 26425773 missense
R0039:Sec16a UTSW 2 26423914 missense probably benign 0.03
R0095:Sec16a UTSW 2 26425760 splice site probably null
R0095:Sec16a UTSW 2 26425760 splice site probably null
R0189:Sec16a UTSW 2 26424414 splice site probably null
R0255:Sec16a UTSW 2 26431186 missense probably damaging 0.97
R0278:Sec16a UTSW 2 26428316 missense probably damaging 1.00
R0739:Sec16a UTSW 2 26441051 missense possibly damaging 0.94
R0743:Sec16a UTSW 2 26419722 missense possibly damaging 0.67
R1446:Sec16a UTSW 2 26423567 missense probably benign 0.00
R1466:Sec16a UTSW 2 26431157 missense probably damaging 0.98
R1466:Sec16a UTSW 2 26431157 missense probably damaging 0.98
R1501:Sec16a UTSW 2 26440045 missense probably benign 0.16
R1524:Sec16a UTSW 2 26428382 missense probably damaging 1.00
R1584:Sec16a UTSW 2 26431157 missense probably damaging 0.98
R1649:Sec16a UTSW 2 26425524 missense probably damaging 1.00
R1744:Sec16a UTSW 2 26439186 missense probably damaging 1.00
R1959:Sec16a UTSW 2 26430132 missense probably benign 0.00
R1973:Sec16a UTSW 2 26426489 missense probably damaging 1.00
R2005:Sec16a UTSW 2 26439080 missense probably benign 0.27
R2073:Sec16a UTSW 2 26440239 missense probably damaging 1.00
R2074:Sec16a UTSW 2 26440239 missense probably damaging 1.00
R2075:Sec16a UTSW 2 26440239 missense probably damaging 1.00
R2151:Sec16a UTSW 2 26413745 intron probably benign
R2472:Sec16a UTSW 2 26439936 missense probably damaging 1.00
R2512:Sec16a UTSW 2 26439025 missense probably benign 0.00
R2520:Sec16a UTSW 2 26441356 nonsense probably null
R2571:Sec16a UTSW 2 26439331 missense probably benign 0.08
R3105:Sec16a UTSW 2 26438421 missense probably benign 0.14
R3508:Sec16a UTSW 2 26425850 missense probably damaging 1.00
R3809:Sec16a UTSW 2 26441813 missense possibly damaging 0.71
R3912:Sec16a UTSW 2 26414387 missense probably damaging 0.97
R4292:Sec16a UTSW 2 26422155 missense probably benign 0.01
R4293:Sec16a UTSW 2 26422155 missense probably benign 0.01
R4294:Sec16a UTSW 2 26422155 missense probably benign 0.01
R4576:Sec16a UTSW 2 26431119 nonsense probably null
R4611:Sec16a UTSW 2 26441805 missense probably benign 0.04
R4627:Sec16a UTSW 2 26429393 missense probably damaging 1.00
R4627:Sec16a UTSW 2 26431068 unclassified probably null
R4662:Sec16a UTSW 2 26430570 missense probably damaging 1.00
R4665:Sec16a UTSW 2 26412958 intron probably benign
R4906:Sec16a UTSW 2 26441967 unclassified probably benign
R4967:Sec16a UTSW 2 26412871 missense probably benign 0.00
R4983:Sec16a UTSW 2 26439519 missense probably benign
R5033:Sec16a UTSW 2 26419649 missense probably benign 0.00
R5251:Sec16a UTSW 2 26439345 missense probably benign 0.00
R5391:Sec16a UTSW 2 26440032 missense possibly damaging 0.82
R5457:Sec16a UTSW 2 26440268 missense probably benign 0.01
R5530:Sec16a UTSW 2 26439252 missense probably benign 0.00
R5645:Sec16a UTSW 2 26439895 missense probably benign 0.01
R5661:Sec16a UTSW 2 26439637 missense probably benign 0.01
R5770:Sec16a UTSW 2 26414390 missense probably damaging 0.99
R5830:Sec16a UTSW 2 26440841 missense probably benign 0.15
R5866:Sec16a UTSW 2 26419638 missense probably benign 0.00
R5875:Sec16a UTSW 2 26433367 missense probably damaging 1.00
R5906:Sec16a UTSW 2 26438831 missense possibly damaging 0.63
R5922:Sec16a UTSW 2 26415639 missense probably benign 0.05
R6076:Sec16a UTSW 2 26423942 missense probably damaging 1.00
R6091:Sec16a UTSW 2 26426470 missense probably damaging 1.00
R6295:Sec16a UTSW 2 26428241 missense probably damaging 1.00
R6302:Sec16a UTSW 2 26425805 missense probably damaging 1.00
R6309:Sec16a UTSW 2 26438571 missense probably benign 0.00
R6459:Sec16a UTSW 2 26423500 missense probably benign 0.04
R6520:Sec16a UTSW 2 26426106 missense probably damaging 1.00
R6631:Sec16a UTSW 2 26439957 missense probably damaging 1.00
R6657:Sec16a UTSW 2 26425864 nonsense probably null
R6750:Sec16a UTSW 2 26440018 missense probably benign 0.00
R6852:Sec16a UTSW 2 26441419 missense probably damaging 0.99
R6967:Sec16a UTSW 2 26430486 missense probably damaging 1.00
R6968:Sec16a UTSW 2 26430486 missense probably damaging 1.00
R6970:Sec16a UTSW 2 26430486 missense probably damaging 1.00
R6991:Sec16a UTSW 2 26430486 missense probably damaging 1.00
R6993:Sec16a UTSW 2 26423574 missense probably damaging 0.99
R7009:Sec16a UTSW 2 26436002 nonsense probably null
R7057:Sec16a UTSW 2 26425265 missense probably damaging 1.00
R7186:Sec16a UTSW 2 26440703 nonsense probably null
R7227:Sec16a UTSW 2 26438923 missense probably benign 0.01
R7234:Sec16a UTSW 2 26439768 missense probably damaging 1.00
R7259:Sec16a UTSW 2 26441592 missense probably benign 0.00
R7326:Sec16a UTSW 2 26439717 missense unknown
R7371:Sec16a UTSW 2 26441722 missense probably benign
R7388:Sec16a UTSW 2 26428364 missense
X0011:Sec16a UTSW 2 26415643 missense probably damaging 1.00
X0034:Sec16a UTSW 2 26416697 missense probably benign 0.07
X0062:Sec16a UTSW 2 26416697 missense probably benign 0.07
Z1088:Sec16a UTSW 2 26439093 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GACAAATGTCAATCCAAGGGCC -3'
(R):5'- TGCCTAGGACCAACAGTGTACC -3'

Sequencing Primer
(F):5'- GTCAATCCAAGGGCCAATATTG -3'
(R):5'- AACAGTGTACCCACAGTCTTTC -3'
Posted On2018-09-12